Selecciona Edición
Conéctate
Selecciona Edición
Tamaño letra

Entrevista con David Bustamante

Cantante

Entrevista con David Bustamante

Su paso por Operación Triunfo, la grabación de su disco y su recién estrenada popularidad han sido algunos de los temas que tratados en la charla que el cantabro David Bustamante ha mantenido con los internautas de Los40.com, ELPAIS.es y Portalmix.com.

1Object24/06/2002 12:57:21

David:¿Cómo te sientes al ver que miles de fans hacen lo que sea por verte y conseguir un autografo tuyo,cuando hace apenas un año eras tu uno de esos fans?Un beso enorme,guapeton,Silvia(Madrid)

soy tremendamente feliz, por eso siempre que tengo oportunidad os lo agradezco.

2Object24/06/2002 01:00:01

¿Que vas a hacer despues de todo el verano de gira? ¿Te tomaras una vacaciones, empezaras con otro disco, promocionaras por fuera de España el disco actual...? Patricia (Castellon)

me gustaria promocionar mi disco en America,y cuando vuelva a seguir trabajando en mi proximo proyecto.

3Object24/06/2002 01:05:30

Si la mala suerte te siguiera y te hundieras como artista, ¿Volverias a subirte a un andamio y continuar con tu anterior vida? Lidia

Yo no dejaria de trabajar y de luchar por lo que creo y amo.

4Object24/06/2002 01:06:39

david cuando viste tu disco, en el que salias tú y en el que tu cantas, ¿que pensaste? Silvia

¡¡¡lo consegui!!!

5Object24/06/2002 01:09:06

bustamante¿ que piensas sobre la pirateria?

es la manera de destruir artistas y quitar la oportunidad a nuevos talentos.

6Object24/06/2002 01:11:10

Bustamante, ¿cuáles son tus prioridades en la vida?

mi familia,mis amigos y mi trabajo en la musica.

7Object24/06/2002 01:13:25

¿Que se siente en un escenario al ver tanta gente gritando y cantando tus canciones?

eso es lo mas grande que le puede pasar a un artista,es algo indescriptible,algo magico.

8Object24/06/2002 01:16:36

¿Si no hubieras elegido ser cantante que otra cosa hubieras sido?

no imagino mi vida si no es encima de un escenario

9Object24/06/2002 01:19:26

Eres el mejor que ha salido de esa academia pero ¿Como llevas las criticas que se te hacen en muchos medios de comunicación?. Sigue asi y llegaras muy lejos, un beso enorme.

bien porque tiene que haber de todo y hay que saber aceptar las criticas de uno mismo,es mas, me hace crecer.

10Object24/06/2002 01:21:47

¿Como es un dia normal en la vida de BUSTAMANTE? Un Saludo

mucho curro

11Object24/06/2002 01:22:43

¡Hola tesoro! Mi pregunta es muy sencilla, ¿a que dedicas tu tiempo libre? Un besazo muy fuerte de una chica que espera impaciente que lleve el dia 10 de agosto. Ruti.

a estar con mi gente

12Object24/06/2002 01:23:58

David, ¿con que estilo de canción te encuentras mejor cantando: con las baladas o con las canciones más movidas?

cada estilo tiene su gracia y disfruto con ambas.

13Object24/06/2002 01:28:44

¿ Crees que este boom terminara ?

yo me encargare de que no suceda, haciendo buenos trabajos y como siempre vosotros decidireis por que sois los que teneis la ultima palabra.

14Object24/06/2002 01:35:09

Buenos dias David, ¿Donde te planteas vivir despues que terminen todas las giras? Un beso.

tendre que vivir entre madrid y barcelona,donde requiera el trabajo.

15Object24/06/2002 01:37:16

que le dirias a toda la gente que le gustaria llegar donde tu has llegado?

que luchen por lo que mas desean, que trabajen con la misma ilusión que yo.

16Object24/06/2002 01:38:48

¿Qué aconsejarías, desde tu experiencia como concursante, a todos los candidatos de la nueva edición de O.T? Esteban(Barcelona)

que escuchen, que aprendan y que disfruten....

17Object24/06/2002 01:51:48

MENSAJE DE DESPEDIDA:

bueno, os dire que estoy ensayando con mis musicos y preparandolo todo para esta gira que me acercara a vosotros con conciertos este verano.cuento con vosotros y os agradezco todo el apoyo.¡¡¡OS QUIERO!!!

18Object21/06/2002 08:20:30

Porqué parte de tus conciertos serán con Verónica y no con Gisela? Un saludo. JOHSUA.

Object

19Object21/06/2002 08:21:05

Hola Busta. Qué tal estas?¿ Espero que muy bien y que sigas asi durante mucho tiempo. ¿ Estas contento con tu disco?. Es uno de los mejores que he escuchado.A ver si cuando hagas un concierto aquí en Madrid o en Murcia puedo ir a verte.Que tengas mucho éxito y que te vaya binoto como dice la canción de Rosana. Un besazo guapetón. Esther(Madrid)

Object

20Object21/06/2002 08:22:08

Hola David, soy Carmen nik es espanyola supongo k ya me conoceras...No podre estar el lunes aki contigo, solo kiero desearte suerte y espero k te haya gustado lo k te envie. Espero recibir noticias tuyas. Gracias por todo. Una Murciana.

Object

21Object21/06/2002 08:23:34

¡hola! queria preguntarte una curiosidad:ahora que ha cambiado tu ritmo de vida, tu dinero... ¿has cambiado en algo??

Object

22Object21/06/2002 08:24:02

Hola Busti.Soy una chiquita de tu club de fans. ¿Qué tal te va? seguro que muy bien.¿Te esperabas esto de la fama? ¿Cómo te sientes después de esta revolución de operación triunfo? Un besito y que sigas así de guapo y cantando así de bien. Te mereces lo que tienes y más. Esther ( Madrid ).

Object

23Object21/06/2002 08:24:18

busta ¿crees que bisbal va a vender más discos que tú?

Object

24Object21/06/2002 08:25:14

Hola David , soy nuria ¿Como te quedaste cuando te dijeron que habias vendido medio millon de discos?.Que todo te valla bien.

Object

25Object21/06/2002 08:25:46

David,se que vas a ir a la isla de Ibiza hacer un concierto,la conoces?yo soy de ahi y si tienes tiempo de conocerla haslo te gustara,besos y adelante tus disco es muy bonito.Ros de Ibiza

Object

26Object21/06/2002 08:25:51

Porque eres tan sentimental, osea que sientes antes de ponerte nostalgico???

Object

27Object21/06/2002 08:26:56

Cuando sale un disco con rosa??

Object

28Object21/06/2002 08:26:59

Hola busta,me llamo Diana y soy una gran fan tuya y de tus compis. Me gustaria saber si pensabas hace unos meses todo lo que te podia pasar al entrar en operacion triunfo, y como llevas esto de estar tan alto del estrellato. adios y buena suerte ¡¡¡¡guapo!!!!

Object

29Object21/06/2002 08:27:10

Soy una fen de Ibiza y tengo ganas de verte en concierto,espero que te guste la isla,la conoces? besos de Eva

Object

30Object21/06/2002 08:27:42

HOLA me llamo patri me ustaria preguntarte k si tienes algo x hay xDDDD yo te gustare no me dejes escapar

Object

31Object21/06/2002 08:28:37

hola busta!! soy una fan tuya aunq me gusta más àlex :) , y qria preguntarte q si apartir de ahora seguiras teniendo esa maravillosa relacion de amistad con àlex ?? besos de la fan nº1 de àlex!!!

Object

32Object21/06/2002 08:29:27

David eres el mejor y el más guapo, ¿cuando vendras a Valencia a firmar discos o de concierto con tu gira?. Ana, Valencia.

Object

33Object21/06/2002 08:30:15

Hola busta,felicidades por tu disco que es inmejorable. ¿Cuando empezaras tu gira por America latina? alli te quieren mucho, como yo. muchos besos,espero verte en Santo domingo. (merrily) laura logroño

Object

34Object21/06/2002 08:30:35

¿En tus planes esta visitar Costa Rica, Centroamerica?

Object

35Object21/06/2002 08:30:36

david,vas a venir a VALENCIA a firmar tu disco? eres el mejor,TE KIERO ARTISTAZOOOOOOO!!!!!!!!

Object

36Object21/06/2002 08:31:11

Hola Busta,cuando te vienes para Galicia,exactamente,cuando te vienes a Redondela,un pueblo al lado de Vigo?Respondeme a niki17@eresmas.com ¡¡¡VIVA SAN VICENTE DE LA BARQUERA Y VIVA LA MADRE QUE TE PARIO,QUE BUENO ESTAS!!!!

Object

37Object21/06/2002 08:32:14

hola david , te vi en el hotel de madrid, el viernes despues de tu gala y te vi muy contento ¿q significo para ti tu homenaje en san vicente? yo fui quien te dio el muñeco con la camiseta q tenia tu foto,espero q te gustara.Ya sabes soy la fan de Naim pero te apreciamos.SARA (MAGNUM)

Object

38Object21/06/2002 08:32:58

Hola Busta me gusta mucho tu disco! es el mejor. Como llevas esto de la fama? seguro que muy boien solo quiero decirte una cosa mas que GISELA me cae genial y me gustaria mucho que estuvierais juntos. te kiere mucho una fan tuya. cris. me pdrias decir como ponerme en contacto contigo? si no te importa. besos guapisimo eres el mejor

Object

39Object21/06/2002 08:33:32

felicidades busta eres todo un amor,¿ cuales son tus proximos proyectos? ¿ en un nuevo disco, o medios de comunicación? te quiere laura logroño, un beso

Object

40Object21/06/2002 08:34:00

¿Qué canción es la k mas te gusta de tu disco? ERes el mejor y sigue asi. Te quiero un monton. Una malagueña! tu cd es el mejor de todos! Tienes muxo salero y muxo arte!!!!!

Object

41Object21/06/2002 08:34:30

HOLA DAVID TE VI EN EL HOTEL DE MADRID DESPUES DE LA GALA DE CANTABRIA, SOY LA FAN DE NAIM(PERO SABES Q TE APRECIAMOS), QUERIA PREGUNTARTE ¿Q SIGNIFICO PARA TI LA GALA? UN BESO DE SARA, TE DI UN MUÑECO CON UNA CAMISETA Q TENIA TU FOTO TE GUSTO? UN BESO.

Object

42Object21/06/2002 08:34:41

xq en canarias vas pa la palma y no pasas por tenerife?un beso.(una fan triste x no poder verte)

Object

43Object21/06/2002 08:35:35

¿ david como te sientes con todo lo que te esta pasando?

Object

44Object21/06/2002 08:36:29

Hola!!! ¿Qué tal David? ¿Te encuentras a gusto con tu cd? A mi me encanta. Eres el mejor. Oye, espero con ansia el concierto de Fontajau (Girona) para poder verte. Besos y gracias por todo.

Object

45Object21/06/2002 08:37:15

¿Si la fama se te gota, que lo dudo porque trabajaras para que no sea asi, que haras, te deciaras otra vez a la construccion, o que harias?

Object

46Object21/06/2002 08:37:28

¿Dijistes que te vendrias a vivir a Barcelona (bendito mar!) pero piensas volver a Cantabría en un futuro?

Object

47Object21/06/2002 08:37:32

ola me llamo Elena y desde la primera vez que te vi supe que ibas aser uno de los ganadores

Object

48Object21/06/2002 08:37:50

porque no haces ningún concierto en bilbao? nos tienes desesperadas. es verdad que se a suspendido tu concierto en santo domingo de la calzada? en donde podemos conseguir las entradas?

Object

49Object21/06/2002 08:39:10

¿De todos los comentarios que te han echo tus seguidores, con cúal te quedas? nuya

Object

50Object21/06/2002 08:39:38

en que zonas haces tu el concierto solo? intenta venir a bilbao porque aqui tienes aun montón de gente que te apoya. intentalo por fa

Object

51Object21/06/2002 08:40:02

Hola busta soy marga desde onil un pueblo de alicante te queria preguntar si te has comprado los cds de tus compis o si te los han regalado? besos. Busta eres el mejor. tu club de fans y tu foro te quieren!!!!!!!!!!

Object

52Object21/06/2002 08:40:43

¿Quieres seguir siendo famoso? o ¿Cómo antes? ¿Por qué?

Object

53Object21/06/2002 08:40:58

cuando estubiste en valencia en el concierto te hicimos una pekeña carta que se la dimos a la corista rubia solo queriamos saber si te la entrego????

Object

54Object21/06/2002 08:41:07

hola BUSTA, mi pregunta es la siguiente,¿crees que has cambio o cambiarás tu actitud hacia la gente por la fama que has cogido?,bueno te mando muchisimos besos desde Vigo.tu fan1.silvia.

Object

55Object21/06/2002 08:41:25

hola me llamo elena soy de cordoba y desde la 1ª vez que te vi supe que serias uno delos ganadores bueno la pregunta ¿como se te ocurrió el presentarte al programa?¿te lo sugirió alguien?si lo leeis os lo agradezco UN BESO ¡ERES EL MEJOR!

Object

56Object21/06/2002 08:41:28

David, somos cuatro hermanas de Veracruz México. Escuchamos en la presentanción de tu disco en Triunfomanía que vas a venir a México, y queremos saber cuando porque creeme que somos tus fans #1 y no nos podemos perder la oportunidad de conocerte en persona.Adriana Carranza-México

Object

57Object21/06/2002 08:41:39

Hola david:1ªpregunta:te quiero mucho,que hago?? 2ªpregunta:vendras a sevilla en tu gira?? te quiero mucho,carlota,sevilla.

Object

58Object21/06/2002 08:41:42

¿Haras una gira aquí en Cádiz? ¿Cuándo?

Object

59Object21/06/2002 08:41:43

Ola david q tal?? me gustaria saber si vas a venir algun dia a firmar discos a Madrid y si sabes donde y cuando. Muchos besos te kiero mucho vane

Object

60Object21/06/2002 08:42:01

cuando vas ha hacer el concierto en solitario en barcelona?

Object

61Object21/06/2002 08:43:28

Tu disco es genial y seguro que seras disco de diamante,¿Cuanto tiempo tardaste en grabar el videoclip?¡¡Gisela tambien es genial!!

Object

62Object21/06/2002 08:43:48

david te quiero mucho,que hago,vendras a sevilla en tu gira??di que sisisiisi,xfa. te quiero carlota.sevilla

Object

63Object21/06/2002 08:43:51

Array

Object

64Object21/06/2002 08:44:01

Hola busta soy marga desde onil un pueblo de alicante. te queria preguntar: Sabes algo de tus firmas de discos? muchas gracias y eres el mejor tu foro y tu club de fans te quieren. besos

Object

65Object21/06/2002 08:44:12

¿ Y para cuando las mujeres, aki tiene una chica de 23 años que estaria encantada de conocerte un poco mas??

Object

66Object21/06/2002 08:44:14

¿Tienes miedo a que otro de los concursantes de Operación Triunfo te haga la competencia? Un beso de una fan que te sigue dia a dia.

Object

67Object21/06/2002 08:44:46

¿que tal tu vida amorosa? ¿Es verda q te gusta gisela? IRENE

Object

68Object21/06/2002 08:44:48

vendras a sevilla en la gira????

Object

69Object21/06/2002 08:45:13

ola bustamante,¿queria saber si no tienes pensado venir a tenerife?,es que aqui nos tienen abandonaditos y nosotros os queremos mucho a todos un beso wapo

Object

70Object21/06/2002 08:45:33

¿Que te parece compartir tu gira con una chica tan excepcional como VERO?

Object

71Object21/06/2002 08:46:13

hola busta!! primero de todo keria decirte ke te kiero un huevo i my madre dice ke eres como su hijo pk tengo cosas tuyas por todas partes... hasta la alfombra del ordenador, imaginate... jeje. mi pregunta es: en kuantos dias gravaste el disco? MUCHOS BESOS Y HAVER CUANDO VIENES A FIRMAR DISCOS MATARO PARK, pero ke no sea a primeros de julio pk estoy de campeonatos de catalunya. ERES EL MEJOR!!

Object

72Object21/06/2002 08:46:14

Hola soy Maria Bien Aparecida de Cantabria y ma gustaria saber que opinas sobre los familiares repentinos que te an salido con la fama. Un beso de tu mayor fan.

Object

73Object21/06/2002 08:46:18

¿Cómo es que en tu gira no vas a coincidir con Gisela?, sois una de las mejores parejas "artísticas" de todas las de la academia. ¿No se puede hacer nada?. Carmen. Córdoba

Object

74Object21/06/2002 08:46:51

David, me encanta tu disco, tu manera de ser...Bueno todo! ¿Has asimilado ya todo el exito que estas teniendo? ¿Alguna vez has sentido verdadera pasión por algun cantante como la que sentimos nosotros (tus fans) por ti? Patricia (Castellon)

Object

75Object21/06/2002 08:46:59

Busta mio, te quieroooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo

Object

76Object21/06/2002 08:47:15

Muchas felicidades a David por lo que a logrado hasta ahora que ojala se multiplique, un beso muy grande, ¿Cuando vienes a México?

Object

77Object21/06/2002 08:47:22

¿que es lo que mas te gusta de ser famoso? Besos.cris

Object

78Object21/06/2002 08:47:31

¿Echas de menos el no tener a la persona, que sería la otra parte de la relación en tus canciones, es decir alguien con la cual pudieses interpretar mejor esas canciones de amor? isabella-alicante

Object

79Object21/06/2002 08:47:54

David, ¿tienes alguna relación sentimental con Gisela? por favor, te pedimos que nos contestes con sinceridad porque es muy importante saberlo para nosotras. Esta pregunta es de parte de dos salmantinas que te quieren y te adoran.

Object

80Object21/06/2002 08:48:05

busta te kiero un huevo! he mandado ya no se kuantas preguntas para haver si las lees y ahora no se me ocurre ninguna... aunke te digo un consejo. Aces muy buena pareja con gisela, sois mis 2 favoritos. Un beso a los 2 i haver si venis a mataro park

Object

81Object21/06/2002 08:48:08

Busta,¿que te parece que mi madre vaya desde San Sebastian hasta Santender solamente para berte a ti? Elene de San sebastian

Object

82Object21/06/2002 08:48:21

¿que es para ti la musica?¿que significa para ti gisela?bueno espero que todo te valla muy bien tu disco fabuloso.mucha suerte en el futuro contaras siempre con mi apollo.

Object

83Object21/06/2002 08:48:29

hola mi nombre es sherry y soy una de las fan numero uno de busta y me gustaria saber que siente cuando se sube al escenario y ve a un monton de gente apoyandole y que le quiere.Y a parte desearle mucha suerte y que se que el 23 de julio tiene su concierto en palma de mallorca y que sepa que tiene todo nuestro apoyo. 1000 besos

Object

84Object21/06/2002 08:48:42

Hola, soy de Panamá,,, (Centroamérica), y apenas estan pasando el programa Operacion Triunfo y van por la gala # 7, por supuesto sé quienes son los ganadores porque vi algunas galas en la por Cable Internacional,,,tienes millones de admiradoras acá... mi pregunta es: Será posible que alguna vez te pueda ver en vivoy conozcas mi pais??? Harías feliz a muchas panameñas... un beso.. exitossss...

Object

85Object21/06/2002 08:48:53

Bustamante, te kiero, eres el mejor. Una cosa, no soy una de esas tipicas fans q tengo todo de ti, ademas de eso, daria mi vida por ti y me gustaria ser una gran amiga tuya, soy de zaragoza, y creo q te mereces mucho el disco de diamante, una pregunta, es verdad q estas saliendo con gisela? es q a todas las fans nos da envidia, jeje, ya sabes; bueno, daria cualkier cosa por conocerte, venga, adios, te kiero!

Object

86Object21/06/2002 08:48:58

que harias por amor?te quiere una manilveña

Object

87Object21/06/2002 08:49:00

hola bustamante soy tu fan numero 1 me llamo silvia tengo 12 años y me encantas la pregunta es ¿como te sientes al ver tu disco tus fotos tus discos de oro y que la gente te quiere? silvia 12 años

Object

88Object21/06/2002 08:49:08

bustamante,¿cuantos años crees que seguiras en la musica?

Object

89Object21/06/2002 08:49:19

Se me ha olvidado preguntarte una cosilla de nada...¿Quieres casarte conmigo? Patricia (Castellon)

Object

90Object21/06/2002 08:49:23

ola busta,¿xq no vienen zipi y zape a tenerife?xq os queremos mucho y haceis un dúo magnífico,un beso . y por cierto felicidades por tu disco q es una maravilla,vaas a llegar muy lejos xq eres un buen cantante y una persona buenísima y eso es lo mas importante.adios wapo.cristina y marta

Object

91Object21/06/2002 08:49:23

¿TIENES PENSADO EN ALGUN MOMENTO HACER UNA GIRA POR AMERICA DEL SUR, ESPECIFICAMENTE EN VENEZUELA?

Object

92Object21/06/2002 08:50:04

¿Piensas en tus discos tener una proyección más internacional y abrirte a otros idiomas como el inglés?

Object

93Object21/06/2002 08:50:10

bustamante eres el mejor, me gustaria saber cual es tu canción favorita de tu disco. Silvia 12 años

Object

94Object21/06/2002 08:50:34

TE QUIERO

Object

95Object21/06/2002 08:51:05

david, te kiero mucho, te admiro mucho, pero estoy muy triste pk soy la unica persona de toda españa q no ha ido a ningun concierto y q tampoco te podra ver en tu gira pk no me puede llevar nadie. Supongo q asi es la vida. SUERTE! NO CANVIES NUNCA!!!!

Object

96Object21/06/2002 08:51:16

bustamante yo cuando vallas a ponferrada te pienso ir a ver y con camara de fotos incluida ¡ guapo!

Object

97Object21/06/2002 08:51:30

Hola!!Busta, quisiera saber si...¿algun día vendras a México?, porque aquí ya queremos verte a ti y tus compañeros como Alex y Bisbal. Te amo, guapo! Atte:liz garfias

Object

98Object21/06/2002 08:51:31

vendras a firmar discos a sevilla???te quiero mucho. carlota.

Object

99Object21/06/2002 08:51:55

Hola David!!!! Soy Daniela, de Córdoba (República Argentina) quería felicitarte por todos tus exitos y desearte que consigas muchos más porque creo que eres una excelente persona. Mi pregunta es si tienes planeado venir alguna vez a mi pais, dado que aqui hay muchos seguidores y tuyos. besos

Object

100Object21/06/2002 08:52:10

¿Alguna vez has tenido un ídolo? No me refiero que admires a alguien, me refiero a un "ídolo" por el que harías cualquier cosa.

Object

101Object21/06/2002 08:52:29

Tenes pensado promocionar tu disco por Argentina? Bueno te felicito por tu cd... me parece muy bueno! te mando un beso grande Tu admiradora argentina numero 1! Sol soy_sol@hotmail.com

Object

102Object21/06/2002 08:52:32

Hola David quiero que sepas que eres el mejor y tambien me gustaria que me contestaras una cosa ¿como te sientes al firmar autografos de tantas personas? Silvia Martín 12 años

Object

103Object21/06/2002 08:52:40

¿Por qué no vienes a San Sebastián en tu gira? No se si te acuerdas pero cuando saliais del hotel en el bus hablaste por la ventanilla con una amiga mia que iva en el coche y se lo prometiste, a ver si te vemos por aqui algun dia. Eres el mejor, te kiero mogllon y no cambies nunca!!!!! tu disco es estupendo, me encanta ya ver si consigues 1.000.000 de copias. Eres el mejor, y el mas wapo y que estas pa comerte!!!!!!

Object

104Object21/06/2002 08:52:52

Desde la delegación del club de fans en Galicia tenemos un regalo para ti,¿será posible hacértelo llegar personalmente? Besos ARTISTA, chiq16

Object

105Object21/06/2002 08:53:21

Soy de una zona de Madrid y el concierto más cercano que vas a hacer es en Aranjuez, soy de Alcalá, y me gustaria poderte ver cerca de aqui es que no creo que pueda ir a Aranjuez ¿Podras?Sino puedes no pasa nada con el trabajo que tienes es normal.Tu disco es genial igual que tú. ¡Guapo! Mofletilla

Object

106Object21/06/2002 08:53:34

me quieres?? carlota.sevilla.

Object

107Object21/06/2002 08:53:38

Bustamante tu disco de vende mas rapido que nada ¿como te sientes? silvia

Object

108Object21/06/2002 08:53:52

bustamante, la firma de discos en barcelona se suspendio, vendras a firmar discos a barcelona? cuando? i a que hora?

Object

109Object21/06/2002 08:53:54

si te fueras a una isla desierta que te llevarias contigo? yo si pudiera te llavaria a ti

Object

110Object21/06/2002 08:53:58

busta como te sientes ahora q todo el mundo te conoce?

Object

111Object21/06/2002 08:54:29

ven a México porfavor, que te amo y quiero verte, no puedo estar sin vos.Besos. Atte: liz garfias

Object

112Object21/06/2002 08:55:22

Bustamante quiero que sepas que a mi me encantaria haber ido a la gira pero no quedaban entradas para murcia y soy muy pequeña para ir a otra ciudad pero que estoy loca por ti y tengo la habitación llena de ti silvia 12 años

Object

113Object21/06/2002 08:56:44

¿Te gustaría conocer personalmente algun día a TODOS tus fans, a los que consideras amigos, y poder compartir vuestras opiniones y pensamientos? Una amiga para siempre, tic.

Object

114Object21/06/2002 08:56:50

¡Hola Guapetòn!Soy una Granaina con muchas ganas de conocerte. Estoy un poquitìn depre;Por què no vienes por aquì que te enseñe la tierra de nuestra Rosita?Vas a todas las ciudades andaluzas menos aquì. ya te vale! Intentalo, irè cuando sea. besitos. y por cierto: me encanta tu disco y por supuesto tb tù.

Object

115Object21/06/2002 08:57:01

David, estoi loca por ti y por tu voz te felicito personalmente por tu voz i por tu persona. ¿No piensas que eres el chico mas afortunado de este mundo, por ser como ers y por haver passado de albañil a unos de los mejores cantantes del momento(y era tu sueño)?? 1 beso i suerte!! de: ROMINA 14 B.C.N." a i que sepas que tu sueño se a cumplido peró el mio no ( porque es llegar a conocerte) peró me as enseñado a luchar para conseguir-lo!!!

Object

116Object21/06/2002 08:57:35

¡Hola Guapetòn!Soy una Granaina con muchas ganas de conocerte. Estoy un poquitìn depre;Por què no vienes por aquì que te enseñe la tierra de nuestra Rosita?Vas a todas las ciudades andaluzas menos aquì. ya te vale! Intentalo, irè cuando sea. besitos. y por cierto: me encanta tu disco y por supuesto tb tù.Aly

Object

117Object21/06/2002 08:59:05

busti ¿has pensado alguna vez que antes tu tenias en la mano discos de tus idolos que te encantaria ver a tus idolos que tenias fotos de ellos por todas partes y que ahora es la gente de españa la que te tiene a ti por todas partes? silvia

Object

118Object21/06/2002 08:59:56

Hola David que tal? Bueno supongo que un poco cansao pero yo se que eres un chico fuerte y podras aguantarlo.Soy Jenni desde andorra de los pirineos y me gustaria saber si algun dia te podremos tener aqui. Un beso y que sepas que eres el mejor y que estas muy bueno. ADEU

Object

119Object21/06/2002 09:00:10

Hola!Soy Aida, 16 años, de Barcelona,...y tu fan número 1!Bueno las preguntas: Como puede ser que estés tan bueno? como podria bajarte 7 tonos? estas saliendo,... con mi paisana Gisela? TE QUIERO MUCHO! VENDITO SEA EL ALBAÑIL QUE TE HIZO POR QUE HIZO UNA VERDADERA OBRA DE ARTE! GUAPO!

Object

120Object21/06/2002 09:00:33

bustamante ¿cual a sido lo peor de tu fama?¿por que? silvia 12 años besos

Object

121Object21/06/2002 09:01:48

vas a passarte algun dia por Granollers (barcelona) ?????

Object

122Object21/06/2002 09:01:57

harás tu próximo disco para el verano que viene o descansarás un año antes de sacarlo?

Object

123Object21/06/2002 09:02:32

Bustamante , ¿cuando vas a venir a firmar autografos a Santander. Lidia santander

Object

124Object21/06/2002 09:02:40

Tengo muchas ganas de conocerte. ¿Cuando haras la firma de discos por Madrid? Eres el mejor. AR

Object

125Object21/06/2002 09:02:42

busta soy una fan tuya me llamo monica,tengo 14 años y soy de barcelona.queria decirte que eres el mejor y que soy socia de tu club de fans oficial para apoyarte.tu disco es una pasada, me gustaria saber cual es tu cancion preferida. adios wapo!

Object

126Object21/06/2002 09:03:18

Hola David.¿Que sentiste la primera vez que tuviste en tus manos tu CD ya terminado?No cambies nunca.Un beso.Sandra(León).TQM.

Object

127Object21/06/2002 09:04:31

Hola cariño.Me llamo Ingrid y soy de barcelona.Me gustaria preguntarte si todo lo que te ha sucedido lo consideras positivo o existe algun parte negativa que no se vea.UN beso y no cambies nunca,vale?

Object

128Object21/06/2002 09:04:41

hola david yo soy cristina de colombia y no me pierdo nada que tenga que ver con operacion triunfo te quisiera preguntar si algun dia piensas venir a colombia???

Object

129Object21/06/2002 09:05:12

¿q sientes cuando sabes q en muchas casas españolas,en los coches...suena tu voz y todo el mundo se sabe tus canciones? Un besazo de Teresa una paisana tuya de Torrelavega, y sigue así q nunca te faltará nuestro apoyo

Object

130Object21/06/2002 09:06:36

hola busta soy una muy fan tuya ya q tengo todos los cds de ot y el tuyo komo no ¿como podria hablar contigo? contexta xfa adios wapo y un besazo muy grande.

Object

131Object21/06/2002 09:06:57

Hola Busta!! mi nombre es Ariadna soy de Barcelona y tengo 15 años. Quiero que sepas que soy tu fan nº1 y seré tu fan más fiel porque pienso estar a tu ladooo toda mi vida, tengo tantas cosas que decirte pero boy a ir al grano... Podrias enamorarte de una fan? como yo jaja ogala. Te quiero muxo!!

Object

132Object21/06/2002 09:07:19

hola david, no se si habras leido un e-mail mio, pero soy la de alemania. y solo te quería decir que eres genial, y que voy a ir a un concierto tuyo, el de benalmadena. vas a dar un concierto en caceres, en el mes de agosto?

Object

133Object21/06/2002 09:07:36

hola busta! me llamo henar no kreo ke m,e konozkas aunke hace un tiempo una chica te dio unas kartas de las kuales una era mia.He visto tu lista de la gira y no pasas por ninguna zona de euskadi!!!!!! estoy un poko moskeada no se porke sera me lo puedes decir tu? igual no sabes nada pero me podrias aklarar el tema? a y kuando salen las entradasd la venta?donde saldran? si no viens aki me daria mucha pena pero a un gran artista koimo tu voy a verte donde haga falta! me enkanat tu disko y me nekantas!!!bueno si recibistes mi karta ya sabras ke estoy loka por ti!!!!!!!!y sobre todo por tu musika!!!!!! bueno busta espero ek algun dia puedakonocerte aunke eso sea muy dificil pero intentare hacer lo ke seapara verte de cerca!!! un beso musu bat y espero ke te pases por aki ke aki tambien te keremos y te hemos apollado mucho! agur guapo! por cierto no se komo va esto, me refiero pa ke kontestes a si ke por si akaso te dejo mi email: henargarmar@hotmail.com

Object

134Object21/06/2002 09:07:40

Hola David que tal? Supongo que un poco cansao pero yo se que eres un chico fuerte y podras aguantarlo. Soy Jenni desde andorra,en los pirineos,y me gustaria saber si algun dia te podremos rener aqui.Un beso ,que eres el mejor y que estas muy bueno. ADEU

Object

135Object21/06/2002 09:08:19

¿TIENES UNA TIA POR PAMPLONA, QUE SE LLAMA ROSA HOYOS? SOMOS TRES CHICAS DE UN GRUPO DE ENCAJERAS DE BERRIOZAR+

Object

136Object21/06/2002 09:08:43

Hola mi niño. Que opinas de toda la inmensa cantidad de gente que te sigue? cual es para ti tu fan ideal? Un beso muy grande Ingrid de Barcelona

Object

137Object21/06/2002 09:08:52

Hola busta, tu practicas Kick Boxing? Yo tambien practico este deporte me gusta mucho. Que cinturon tienes?

Object

138Object21/06/2002 09:11:13

Como te suelen gustar las chicas? Que piensas ahora que tantas chicas van detras de ti y puedes estar con la que quieras?eres el mejor!!!!Laura (alicante)

Object

139Object21/06/2002 09:11:50

¿Qués es para ti la fama?¿y el éxito? Belén,Cádiz.

Object

140Object21/06/2002 09:12:41

hola busta! me llamo henar no se si sabras kien soy porke hace poko kreo ke recibistes una karta mia.He visto tu lista de la gira y veo ke no pasas por ninguna zona de euskadi!!!!!! no se porke sera pero si lo sabes me lo podrias decir por favor??? y kuando salen ala bvenmta las entradas? en donde? por cierto ke aunke me de mucha pena ke no vengas por akui a un artista komo tu se le va a ver a donde haga falta!!!!!!! asi ke si hay ke ir se va !bueno david espero ek tye llege mi pregunta y ke me puedas kontestar. tambien decirte ke me enkantas y ke ya te lo dije en la karta. estoy loka por ti.. y sobre todo por tu musika!1espero ek sigas triunfando y sakando muchos diskos pa ke podamos disfrutar de la buena musika!te kliero mucho david eres muy grande!!!!! por cierto no se komo sera lo de kontestrar pero por si akaso aki te dejo mi email: henargarmar@hotmail.com . un beso( musu bat)

Object

141Object21/06/2002 09:14:12

Hola Busta!! Mi nombre es Ariadna soy de Barcelona y tengo 15 años. Quiero que sepas que soy tu fan nº1 y la más fiel porque pienso seguir tu trayectoria toda mi vida. Tengo tantas cosas que decirte en fin que, te quiero mucho! Me gustaria saber cuando vas a hacer la firma de discos para que me lo firmes y poder cumplir uno de mis sueños que es verte? También me gustaría saber como puedo unirme a un club de fans tuyo ya que no se como se hace?

Object

142Object21/06/2002 09:14:16

¿Crees que se te está dando una promoción justa con respecto a otros compañeros de Academia?Mis más sinceros abrazos.Chiqui

Object

143Object21/06/2002 09:16:01

hola busta, eres el mejor. ¿el anillo que te dio tu hermano, te a dado suerte en los ultimos dias de tu vida? marta, barcelona.

Object

144Object21/06/2002 09:16:28

¿algunavez,vas a ir a extremadura?en concreto a navalmoral.bea.una fans muy enamorada de ti.tu fan nº1.te amo

Object

145Object21/06/2002 09:16:35

Hola guapo ante todo quiero darte la enhorabuena por tu disco y quiero decirte que tienes una voz preciosa. Además quisiera preguntarte qué sientes cuando estás en el escenario? te quiero muxo.Rosa

Object

146Object21/06/2002 09:16:58

HOLA DAVID SALUDOS DESDE PUERTO RICO. QUISIERA SABER CUANDO VIENES PARA PUERTO RICO?

Object

147Object21/06/2002 09:17:16

¿cuando empiezan tus conciertos por españa ? vas a pasar por cordoba

Object

148Object21/06/2002 09:17:47

¿cuando haras tu proximo disco?

Object

149Object21/06/2002 09:17:57

hola David!!!!soy María de Sevilla(15 años).quería saber si vas a firmar discos akí. también tu nº de pie y tu talla de calzoncillos,jjejejje.muchos besos para el mejor artista,cantante y persona de la historia del mundo.cásate conmigo!!!te quiero.mov:655248209

Object

150Object21/06/2002 09:18:03

cual es tu cancion favorita de tu disco.como puedo conocerte.guapoooooooo,paisano.

Object

151Object21/06/2002 09:18:06

Hola Busta!!!!!!! mi nombre es Ariadna soy de Barcelona y tengo 15 años, soy tu fan nº1 y la más fiel ya que pienso seguir tu trayectoria toda mi vida. Me gustaría saberque relacióntienes con Gisela ya que me gusta mucho y haceís muy buena pareja? Yo siempre digo o estas conmigo o estas con ella jaja.

Object

152Object21/06/2002 09:19:22

Hola me llamo Estrella y vivo en Caracas donde te queremos mucho. Busta ¿Consideras que tu estilo se puede parecer al de Luis Fonsi?,¿ACCEPTARÍAS UNA INVITACIÓN PARA VENIR A vENEZUELA????

Object

153Object21/06/2002 09:19:48

ya sabemos que tu gran deseo se ha hecho realidad: el llegar a dedicarte a la música, tu gran pasion, pero ¿hay algún otro deseo que le quede a bustamante por cumplir?

Object

154Object21/06/2002 09:20:06

¿Cuántas copias llevas vendidas?¿Por qué siempre dicen más de medio millón y no actualizan las cifras? Yo intuyo por donde andas....Besos enormes. Te quiero, Isabel

Object

155Object21/06/2002 09:20:13

y si pasas por alguna provincia me lo duedes avisar por favor mi telefono es (957)630899 mellamo mari angeles carmona

Object

156Object21/06/2002 09:22:30

HOLA! Tu amor por ahora es la música pero...¿dejarías la música por amor?Me encanta tu disco corazón.Mil besazos.

Object

157Object21/06/2002 09:27:04

¿cuando vas a venir a jerez de la frontera (cadiz) ? ¿ me puedes mandar la respuesta a J_d_c_g@portalmix.zzn.com?

Object

158Object21/06/2002 09:27:17

Hola Busta , como podría llegar a conocerte tan solo tengo 15 años y a Álex a tí os quiero un monton(no seaís tan traviesos Zipi y Zape)¿Como te surgio la idea de entrar a Operación Triunfo? Espero que leas mi mensaje y si puedes me contestas personalmente a mandreusimo@yahoo.es

Object

159Object21/06/2002 09:30:40

hola bustamante. Lo primero decirte que soy una gran fan tuya, que desde el primer instante que te ví en operación triunfo pensé q ibas a llegar muy lejos, no sólo por tu forma de cantar, que es sin duda estupenda, sino también por tu gran personalidad. mi motivo no era hacerte ninguna preguta, lo único que quiero con ésto, es que sepas la manera que tengo de pensar hacia ti. Y esta es unas de las oportunidades para decírtelo. Sigue así, eres el mejor.Por favor leersela para hacersela cominicar. Mercedes.

Object

160Object21/06/2002 09:30:54

oye porfavor me podrias decir cuando va a ser la firma de discos en valencia?es q voy loca preguntando a todo el mundo si se sabe algo.si lo sabes muchas gracias si no ya me enterare en el super foro.gracias aupa busta

Object

161Object21/06/2002 09:32:14

bueno cuando sera la firana de discos en valencia? muchas gracias.aupa busta

Object

162Object21/06/2002 09:32:21

Me podrias decir una cosita: si tuvieras alguna propuesta de cancion escrita por un admirado/a lo haceptarias como una futura cancion? lo digo porque yo suelo escrivir poesia y tengo digamos que imposibles proyectos que si leyeras podrian ser canciones para tu propio cd, ya que me he insìrado oyendo tu melodia, tu voz, tu alma al fin y al cabo! me haria mucha ilusion que contestaras Gracias por escucharme animo porque vales mucho, te mereces esto y mucho mas! Sheyla March Crespo ( Barcelona) Vendras a Barcelona a firmar cd's algun dia?

Object

163Object21/06/2002 09:33:38

Hola BUSTA, ke tal??????como estas?????como van las ventas?????No es ya disco de diamante???'me encanta tu disco es el mejor de todos y tu tambien eres el mejorr chao espero que me contestes.

Object

164Object21/06/2002 09:34:34

Me llamo Laura soy de Uruguay y queria decirle a David Bustamante que es un gran artista,aqui es realmente un Idolo y sus temas se escuchan por todas las emisoras de radio,junto con Gisela hacen un duo increible!!sus actuaciones son el comentario de todo el personal en donde trabajo ya que los seguimos por el canal internacional mi pregunta es si tienen pensado venir algun dia para America y deleitarnos con su hermosa voz!!mil besos desde este pais tan pequeño pero que tanto te admira!!

Object

165Object21/06/2002 09:36:43

Bustamante eres el mejor y espero k te vaya bien tu gira. Te quiero hacer una pregunta: ¿Te gustaría haber hecho el concierto con Gisela?

Object

166Object21/06/2002 09:38:31

Te gustaría que tu disco en solitario llegué a otros paises como sudamerica... soy gran admiradora tuya... TE QUIERO BUSTAMANTE. y espero que pronto pueda escuchar tú música aquí en Perú.

Object

167Object21/06/2002 09:38:37

Como te ves dentro de 20 años? Te gustaria hacer otra cosa que no fuera la musica? No cambies nunca un beso de Leticia

Object

168Object21/06/2002 09:38:40

ola busta. antes eras albañil. y ahora eres el mejor cantante del mundo. se que cuesta mucho conseguir un sueño. el mio es el de ser actriz. ¿¿¿tú crees que todos o casi todos los sueños se cumplen??? tú as tenido suerte porque el tuyo se a cumplido, el tuyo era de grabar un CD, y te los ganado, tu CD creo que es uno de los mejores con el de Bisba y el de Alejandro, bueno todos son geniales pero el de vosotros tres mejor. Porque tiene distintos tipos de canciones, movidas, baladas, lentas, rapidas,.... tú qué crees que es más fácil, ¿¿ser actriz o ser cantante??. Un besazo de tu gran admiradora. Te quiero. Pamela Lastra. Madrid. ¡¡¡¡¡FELICIDADES POR ESE PEDAZO DE ALBÚM!!!!!

Object

169Object21/06/2002 09:38:57

ME GUSTARIA SABER MUCHO DE COMO FUE EL CASTING Y COMO FUE QUE TE ELIGIERON PARA ENTRAR EN OPERACION TRIUNFO YA QUE YO QUIERO ENTRAR EN OPERACION TRIUNFO DE MEXICO CUAL FUE LA CLAVE DE TU EXITO ?? ME DESPIDO ALBERT MUCHAS GRACIAS SEE YOU LATER

Object

170Object21/06/2002 09:40:33

bustamante hola soy una gran fan tuya queria preguntarte cuales son los puntos de ventas para ir al concierto de vero y tuyo?busta eres el mejor no cambies

Object

171Object21/06/2002 09:40:36

Hola David!Soy una chica de Barcelona y me gustaría saber que significan para ti tus fans, ya que siempre te apoyaremos en todo y estaremos siempre a tu lado. También quería decirte que te admiro muchísimo como artista pero sobretodo como persona, y enhorabuena por ese pedazo de disco k has hecho, es una preciosidad.Gracias por todo. muchísimos besos, Clara.

Object

172Object21/06/2002 09:40:39

Hola Busta: Un saludito desde un pueblo de Extremadura, aunque estoy bastante disgustada ya que hasta el momento no veo que vengas por aquí:) Soy de un publo cerca de Zafra y aún tengo esperanza de que vengas en tu gira para la feria de Zafra, podrá ser? dicha feria es a primeros de octubre. Por cierto, que conozco tu pueblo, SAN VICENTE DE LA BARQUERA:) estuve por allí hace un par de años con mis padres, ¡es muy bonito! pero tampoco mi pueblo esta nada mal:) Yo te doy la enhorabuena por ese peazo de CD que nos has preparado, todos y cada uno de los temas me encantan!! Qué pasa con esas "famosas listas de venta "oficiales"" todos sabemos que ya llevas el Diamante en ventas hace tiempo, pero parece ser que no te lo quieren dar, qué pasa? si puedes contestas ¿Vale? Un abrazo y te deseo todo lo mejor, adelante y sigue mostrando ese peazo de voz que es única e inigualable y por favor no cambies tu forma de ser, aunque ya se hay que madurar pero cuidado con lo que se deja en el camino con la madurez:) Besos, besos, dulces y traviesos, hasta siempre campeón y suerte! spyjuego, Mª Segura Segura

Object

173Object21/06/2002 09:40:58

ahora que estas en el mundo artistico que piensas que te va a pasar. soy fanatica a ti.no me pierdo de ningun capitulo. aca en el ecuador es muy visto ese programa te deseo mucha suerte. te quiere Jenniffer Crespo Ecuador-Guayaquil.

Object

174Object21/06/2002 09:43:53

Hola David!Soy una chica de Barcelona y me gustaría saber que significan para ti tus fans, ya que siempre te apoyaremos en todo y estaremos siempre a tu lado. También quería decirte que te admiro muchísimo como artista pero sobretodo como persona, y enhorabuena por ese pedazo de disco k has hecho, es una preciosidad.Gracias por todo. muchísimos besos, clara

Object

175Object21/06/2002 09:45:19

hola como te sentiste por haber sido finalista en operacion triunfo despues de haber sido nominado tatas veces

Object

176Object21/06/2002 09:47:17

¿Porque no haces concierto en Barcelona?

Object

177Object21/06/2002 09:47:25

HOLA CAMPEON,me llamo judith y soy de bilbao exactamente de barakaldo(en el foro soy bustamantinaaaa) ante todo keria felicitarte por tu disco desde la primera cancion hasta la ultima.me he inventado una poesia para ti el dia que compre el disco no se si te llegara pero te la envio por aki para que la leas.un beso y mi pregunta era::CUANDO SALEN A LA VENTA LAS ENTRDAS PARA TUS CONCIERTOS:UN BESAZO CAMPEON TE MERECES EL DISCO DE DIAMANTE POESIA:Pasando por mi lado EL AIRE QUE ME DAS es todo frescura. ADEMAS DE TI toda tu familia es tambien nuestra familia.Sabemos que NO ERES UN SUPERMAN pero nosotros te hacemos volar.Escuchando CUANDO HACEMOS EL AMOR un lagrima resvala por mi mejilla y toda CANTABRIA anochece y brillan muy fuerte las estrellas.SI TENGO QUE MORIR , ese dia que sea lleno de maor y de BESOS de la gente que me quiere y sin ninguna DUDA DE AMOR porque POR UN BESO DE TU BOCA millones de fans no sabrian que hacer.Tu y Alex, dos grandes amigos, DOS HOMBRES Y UN DESTINO,pero sabemos que siempre estan llenos de amistad.Porque LA MAGIA DEL CORAZON que hay en ti, nos llena los corazones de todas tus fans

Object

178Object21/06/2002 09:47:38

como te sientes ahora ya que eres un gran artista y que as cumplido tu sueño? FELICITACIONES!!!!!!!!!!!

Object

179Object21/06/2002 09:48:05

oye busta kuando vas a venir a valencia es k esoy deseosa de k vengas aki kiero konocerte en persona

Object

180Object21/06/2002 09:48:05

Hola David,soy sara(sira_bustamante en tu foro).Me gustaría saber si vas a hacer firma de discos, y que si es así cuando empezará.Es que estoy deseando poder verte y que me firmes ese peazdo de disco.te quiere y admira, Sara(Bilbao)

Object

181Object21/06/2002 09:52:21

SOY UNA FAN TUYA TE KIERO MUCHO Y TE FUI A VER A LA DISCOGRAFICA DE SABADELL Y ME FIRMASTE UNA FOTO!! TE KERIA PREGUNTAR QUE CUAL ES TU SECRTO PARA TENER TANTA FAMA Y QUE TE KERAMOS TANTO Y TAMBIEN SI SABES CUANDO VAS A VENIR AL CORTE INGLES DE SABADELL A FIRMAR DISCOS! TE KIERO MUCHO DAVID NUNCA HABIA SIDO FAN DE NADIE Y TU HAS SIDO EL PRIMERO GRACIAS POR LEER ESTE MENSAJE.

Object

182Object21/06/2002 09:53:45

hola david, primero de todo, darte las felicidades por ese peazo disco, luego, me gustaria que me dijeras dónde vivis ahora los de operación triunfo, los chicos en un piso y las chicas en otro, o, todos juntos,... tambien me gustaria preguntarte dónde grabaste el disco. besos. De tu fan nº1

Object

183Object21/06/2002 09:53:56

a q ciudades vas a ir a firmar los discos?

Object

184Object21/06/2002 09:55:01

David, sé que tu i Gisela habéis negado muchas veces que estáis juntos. Sólo querría decirte que eso es cosa vuestra, pero que yo de ti lo aprovechava. Vuestro duo es fantastico. Felicidades. Besos

Object

185Object21/06/2002 09:55:44

¿Cual es tu cancion favorita del disco?¿o aquella con la que te identificas mas?

Object

186Object21/06/2002 09:56:05

Hola Busta soy una emeritense (Cristina)¿Por qué comunidades autónomas vas hacer la gira? a mi me gustaría que vinieses a Mérida. Un besazo para ti Busta de

Object

187Object21/06/2002 09:56:29

Hola compañeru q tal????vendrás a Vigo???? eres el mejor espero me contestes esta pregunta que sepas que soi tu fan numero 1 eres el mejor no cambios muchos abrazos Miguel contestame a miguelamaez@hotmail.com

Object

188Object21/06/2002 09:56:32

¿Que 3 cosas(objetos, personas..) te llevarias a una playa desierta?? Un besito txurry

Object

189Object21/06/2002 09:56:39

¿has elegido tu todas las canciones del disco, o ya tenian algunas concretadas para ti?

Object

190Object21/06/2002 09:57:08

CREES QUE LOS CHICOS DE OPERACION TIRUNFO JUNTOS O POR SEPARADO PODRÁN VENIR A UNA GIRA POR ECUADOR, AQUÍ LES ADORAMOS. ERES GENIAL, SUEÑO CONTIGO Y PIDO POR TODOS USTEDES. FER ( ECUADOR)

Object

191Object21/06/2002 09:57:24

David, te llevas de gira a Vero , ¿ no te hubiera gustado mas llevar a Gisela ? Gracias campeon y suerte en este mundo que comienzas y que sera duradero. Francisco de Melilla

Object

192Object21/06/2002 09:57:30

David, aún no me creo que te esté escribiendo a ti, pero bueno, me gustaria felicitarte por el discazo que tienes i decirte que el duo con alex és precioso. Si tubieras un duo con alguna chica, a cual elegirias? Te quiere Mònica(palafolls barcelona) el duo con gisela es genial.

Object

193Object21/06/2002 09:57:36

POR QUE TE PRESENTASTE AL CASTING DE OPERACION TRUNFO????

Object

194Object21/06/2002 09:58:03

Hola Busta soy una emeritense (Cristina). ¿Por qué comunidades autónomas vas hacer la gira? A mi me gustaría que vinieses a Mérida. Un besazo muy fuerte para ti Busta de Cristina.

Object

195Object21/06/2002 09:58:10

¿cómo llevas eso de vender tantos discos?¿no tienes miedo a que sea algo pasagero?yo espero que no, y que sepas que seguiré compando tus discos, eres genial! un besazo. Shaila

Object

196Object21/06/2002 09:58:35

DAVID, ANTES QUE NADA RECIBE UN SALUDO DESDE AMBATO-ECUADOR, AQUI HAY MUCHA GENTE QUE TE ADMIRA, EL PROGRAMA OPERACION TRIUNFO APENAS ACABA ESTE DOMINGO EN EL CANAL QUE LO TRASMITE AQUI, PERO NADIE SE LO PIERDE, EN LA RADIO SON ESCUCHADAS SUS CANCIONES,AHORA QUE TIENES EL CD EN SOLITARIO HAS PENSADO PROMOCIONARLO EN AMERICA DEL SUR, SERIAS MUY BIEN RECIBIDO AMALIA R.

Object

197Object21/06/2002 09:58:41

¿que es lo que mas hechas de menos de tu vida anterior a operación triunfo?

Object

198Object21/06/2002 09:58:47

bueno david mi sueño es k me envies una firma a casa, pero si no lo puedes a cer escribeme algo por correo: esta es mi direccion: c/ Cantabria 79 10º 3ª 08020 Barcelona I mi direccion: patricule@hotmail.com si me icieras este favor cumplirias mi sueño

Object

199Object21/06/2002 09:58:59

tienes novia?

Object

200Object21/06/2002 09:59:16

hola david soy vanesa una chica de logroño me gustaria preguntarte si vas a hacer alguna firma de discos aqui en la rioja porque nosotras queremos verte de cerca ya que si no nos es muy dificil poder verte ya que es una comunidad pequeñita. te quiero vanessa

Object

201Object21/06/2002 09:59:23

Hola David! Tengo 20 años, soy de Málaga y te sigo desde el principio. Me gustaría saber si estas llevando bien lo de perder la "intimidad" y si irás a Méjico. Muchas Gracias por tu CD y por ser así. Muchos besos dulces y traviesos. Te queremos mucho. fdo:mariahginebra@hotmail.com por si quieres decirme algo. çiao

Object

202Object21/06/2002 09:59:57

me gustaria hacerte una propuesta, para el proximo video clip podrias contar con la colaboracion de algunos de tus fans ¿q te parece? si la respuesta es afirmativa, yo me apunto! Shaila(valencia)

Object

203Object21/06/2002 09:59:59

cuando va ha ser tu gira en solitario?

Object

204Object21/06/2002 10:00:18

david estas con gisela? soy una verdadera fan tuya y si es verdad me gustaria felicitarte por ello ya que es una chica muy simpatica. te kierooo vanesa

Object

205Object21/06/2002 10:01:02

Bustamante, ¿eres tu el que contesta a las cartas que se madan a tu club de fans? ¿cuando vienes a sevilla o alrededores a firmar? contestame por favor. Gracias Loli de Sevilla. tu fan numero 1

Object

206Object21/06/2002 10:02:38

bustamante. vendras por granada en tu gira? yo ire a cabra, martos tivoli y frigiliana. me gustaria mucho conocerte, soy de un pueblecito de granada

Object

207Object21/06/2002 10:04:07

Hola David soy Noelia y te escribo desde Uruguay,yo queria saber si daras algun concierto en América cuando termines tu gira por España,y cual sera tu proximo single, sos el mejor y el mas guapo un beso y por aqui te estare alentando siempre te quiero.

Object

208Object21/06/2002 10:05:05

hola david soy una fan tuya me gusta mucho tu disco.¿te gusta el tipo de musica qe te han puesto?¿te gustaria haber ido tu solo a cantar en eurovision?¿como te gustaria ponerle a tu segundo single(disco)?un fuerte beso y abrazo de tu fan:Ana María

Object

209Object21/06/2002 10:05:50

hola david!! soy laura de santander y quisiera felicitarte por elexcelente trabajo que has realizado con este disco y me gustaria preguntarte como fan que es lo que te hemos aportado los fans a nivel presonal. muchas gracias.

Object

210Object21/06/2002 10:06:10

¿Te gustaria hacer un concierto privado solo para tus fans?

Object

211Object21/06/2002 10:07:49

cuantos discos de platino llevas? eres el mejor un beso.

Object

212Object21/06/2002 10:08:29

Busta,sot una chica de Miranda de Ebro en Burgos eres mi favorito desde que te vi por primera vez,tengo todo de ti y yo te quisiera preguntar: ¿Me puedes dedicar una cancion en tu proxima gala guapeton? Me arias la chica mas feliz del planeta por favor corresponde a mi peticion TE QUIERO MUCHO.Minerva.12.

Object

213Object21/06/2002 10:09:17

Busta, después de haber hecho realidad, tu sueño, te queda algo mos por conseguir?Mucha suerte y te deseo lo mejor.¡¡Animo!! raquel_17 Zaragoza

Object

214Object21/06/2002 10:09:19

hola busta somos paqui y bea de malaga,queriamos preguntarte que significo para ti el salir de la academia y ver q tanta gente te apoyaba?gracias,te queremos

Object

215Object21/06/2002 10:10:20

¿estas agusto con tu disco?

Object

216Object21/06/2002 10:12:03

Hola Guapisimo¿q tal estas?soy una de tus mayores fans soy de zaragoza y me gustaria saber si vas a venir a firmar discos a zaragoza y de gira.Porfavor ven,toda la semana q estuvista en zaragoz te he seguido y he estado el la puerta del gran hotel y del principe felipe desde por la mañana y el dia del concierto estuvista genial y te tire un peluche.Besos te quiero guapeton.CRIS I LOVE BUSTA

Object

217Object21/06/2002 10:13:26

Eres el mejor de todos, cantas divino, te deseo lo mejor, quisiera saber: ¿Sientes que todos tus sueños están realizados, o te faltan muchos por conseguir?

Object

218Object21/06/2002 10:14:01

como puedo ser una de tu club de fans yo soy atu fan n 1 desde q te vi entrar por la puerta de "ot" eres el mejor y los seras siempre aupa bustamante¡¡¡¡

Object

219Object21/06/2002 10:14:31

Eres el mejor de todos, cantas divino, te deseo lo mejor, quisiera saber: ¿Sientes que todos tus sueños están realizados, o te faltan muchos por conseguir? María Angel, Ecuador.

Object

220Object21/06/2002 10:14:38

como puedo ser de tu club de fans?????un beso tq alba

Object

221Object21/06/2002 10:14:55

Soy de Ecuador y me encantarían que leas mi pregunta! Quisiera saber si vas a venir de gira a Ecuador y si harías un lanzamiento aquí, porque no sabes cuánto te quiere la gente y cómo quisiera que vengas. "David Bustamante, disco de diamante" Unn besote Vero

Object

222Object21/06/2002 10:15:01

hola busta mi nombre es eunate soy de bilbao querria preguntarte un monton de cosas pero solo te hare dos la primera: queria saber si vas a venir a bilbao y la segunda te esperabas todo este exito y si esperas conseguir el disco de diamante. pero seguro que lo consigues y la ultima pregunta me podrias mandar algo tuyo?

Object

223Object21/06/2002 10:15:21

Hola!Soy Diana de Madrid.Mi pregunta es la siguiente:¿Cómo te sientes después del éxito que has alcanzado en tan poco tiempo?Ha sido impresionante lo que habeis conseguido todos.Un besazo y no cambies

Object

224Object21/06/2002 10:18:07

vas a ir a santander a firmar discos ????? cuando??? besos eres el mejor,!guapoo!

Object

225Object21/06/2002 10:18:18

Hola soy una chica de Santander, llamada Katia Que tal te sentiste en gala que ofrecio Tve1 en tu tierra? te sentiste apoyado y querido?

Object

226Object21/06/2002 10:18:56

Soy de Ecuador y me encantaría que lean mi pregunta. Soy una gran admiradora de Busta y me gustaría saber si va a venir de gira acá a Ecuador y si va a lanzar su disco aquí, porque le iría muy bien y sería un exitazo. Todos aquí le queremos un montón. Esperamos tu disco de diamante. Un besote Vero

Object

227Object21/06/2002 10:19:25

vas ha hacer a alguna visita a santander ????? firmas de discos,promocion,programa...... etc?

Object

228Object21/06/2002 10:21:04

Hola mi niñoo!!! Se sabe algo más de vuestro viaje a Méjico?Y de tus firmas de discos? Firmarás en Bacelona, supongo y deseo que sí! un beso muy fuerte, eres un ARTISTA NATO.Sigue así, y sobretodo, cuídate y sé feliz, que eso es lo más importante.Espero que te trate todo el mundo bien!Haber si la Martita va a tener que enfadarse con alguien!! Un besazo guapetón, y dales un par de abrazos a tus papis y tus hermanos que són geniales. Te quiero un montón, guapetón...jejeje Besos. Marta (La san José!) (tutanjamon75@hotmail.com)

Object

229Object21/06/2002 10:21:11

hola titin¿lees todas las cartas k t enviamos?y ¿conetstas? tania tu fan nº1

Object

230Object21/06/2002 10:22:33

David,ante todo enhorabuensa por tu disco,me encanta todas las canciones desde la 1 a la 11.Que paso con el concierto de Burgos??.Un besito muy grande y no cambies nunca.Te vere en Medina de Pomar

Object

231Object21/06/2002 10:22:48

busta eres el mas wapo del mundo,el mejor,estaras por tenerife?

Object

232Object21/06/2002 10:23:49

hola bustamante .me llamo maria del mar y vivo en palma de mallorca.soy una gran fan tuya y me gustas mucho .he escrito una carta a tu club de fans en cantabria.en julio como vienes a mallorca si puedo ir a verte sin duda lo hare ok cuidate y mucha suerte con el disco q es genial.1 besito.

Object

233Object21/06/2002 10:23:56

¿Cual es tu sueño inmediato? hemos oido muchas veces cuando te preguntan si ya has cumplido todos tus sueños dices que no, que te gustaria que dentro de unos años te reconocieran como uno de los mejores cantantes de lengua hispana, pero ¿que es de estos proximos meses?, ¿que esperas? Nosotras verte en concierto, estamos deseandolo. un beso y todo el apoyo. ELI

Object

234Object21/06/2002 10:23:56

desde uruguay te saluda analaura. bueno mi pregunta ES; COMO TE VES DENTRO DE 5 AÑOS? Y POR QUE? UN BESO DESDE URUGUAY , TE QUIERE ANA LAURA

Object

235Object21/06/2002 10:25:15

David como se puede ser tan buen cantante y mejor persona? un beso

Object

236Object21/06/2002 10:25:36

HOLA, SOY OLOTINA: TU SABES SI CHENOA Y BISBAL ESTAN JUNTOS? SI LO SABES ME PUEDES CONTESTAR, POR FAVOR MUCHAS GRACIAS.MI E-MAIL ES : mireiahll@hotmail.com

Object

237Object21/06/2002 10:25:39

Hola David,antes de todo te queria felicitar por tu disco y te pregunto:seria posible que hagas una gira por Suiza por que aqui(sobre todo en Ginebra) se te quiere y admira mucho

Object

238Object21/06/2002 10:27:03

David,te has planteado como vas a llevar eso,de que todo lo que hagas en tu vida privada despierte interés para la prensa del corazón? Eres el mejor del mundo,y para mi eres todo un superman¡¡un beso.GEMA.ALMERIA.

Object

239Object21/06/2002 10:28:40

David esta pregunta es desde Venezuela, donde es impresionante el exito que tanto tu como todos los chicos de OT, han tenido en mi pais. Tanto es que han sobrepasado fronteras que a partir del movimiento OT en venezuela,se esta tratando de hacer una version del programa mi pregunta es ¿ como hiciste para no estar tan nervioso en los casting porque yo estoy tratando de quedar entre los 14 chicos y la verdad es que los nervios son lo peor y por otro lado, ¿pensaste ya que tu nombre traspaso fronteras, es decir algo asi como de San Vicente de la Barquera a una muy buena parte del mundo como asumes esto y por estos lados del mundo se te quiere muchisimo Besitos y mucho exito... "Porque Bustamante disco de diamante"

Object

240Object21/06/2002 10:29:15

¿Cuál fue tu más grande temor al participar en Operación Triunfo y cuál fue tu máxima alegría?

Object

241Object21/06/2002 10:30:13

Bustamante,¿estás con Gisela?

Object

242Object21/06/2002 10:30:49

hola soy de ecuador y me gustaria conocerlo mas ...me agrada como canta....que hermosa voz tiene lo felicito

Object

243Object21/06/2002 10:31:02

si algun dia va a venir a Chile por que aqui tiene muchas admiradoras

Object

244Object21/06/2002 10:31:51

¿Es verdad que te gusta Gisela?(pero no solo como amiga y compañera, si no como algo más)

Object

245Object21/06/2002 10:32:04

Sabemos que para ti el fisisco es una cuestion de salud,pero,,,¿en los sentimientos de David,influye el fisico de una chica para enamorarse?Ejemplo Rosa Lopez,"mucha suerte titin " 10000 besos .Idaira . Las palmas

Object

246Object21/06/2002 10:32:16

bustamante me gustaria muchisimo k vnrs a zaragoza para el pilar porfa vas a venir un besazo!!ines de zargoza un besazo!!

Object

247Object21/06/2002 10:32:19

¿ Te gustó el recibimiento y la acogida que le dieron los canariones a tu disco el sabado dia 22 de junio?

Object

248Object21/06/2002 10:32:31

¿Por qué no vienes a Bilbao? ¿Vas a venir alguna vez?

Object

249Object21/06/2002 10:32:38

¿Como es tu estilo de chica perfecta?

Object

250Object21/06/2002 10:33:17

Ya vendiste 500.000 copias de tu disco, has triunfado en España, seguramente lo harás en toda Europa, ¿has considerado el mercado de América Latina?, te pregunto porque yo soy tu fans de Chile, y me encantaría que vinieras a mi país.

Object

251Object21/06/2002 10:33:19

Hola David, quiero decirte que eres uno de los mejores artistas que salieron de la academia de operacion triunfo y que te superaste mucho dentro de ella, solo queria preguntrate si tienes pensando traer tu gira a América? aca estamos todos locos por ti y por los demas chicos de operacion triunfo? muchos exitos y a seguir adelante!!! Edgar (Republica Dominicana)

Object

252Object21/06/2002 10:33:36

hola david!!!! soy una fan muy fan tuya y me gustaria preguntarte si es verdad que el 3 de julio firmas disacos en barcelona, en el alcampo de diagonal mar.Porfavor me encantaria saverlo,dilo porfavor. De un fan que te quiere y te admira por ser como eres. 1 besazo enorme de ANNA.

Object

253Object21/06/2002 10:33:54

¿Te gusta realmente esto de cantar, o simplemente viste que se te daba bien y decidiste meterte en este mundillo para dejar de ser un obrero?

Object

254Object21/06/2002 10:33:57

me puedes decir la direccion de la casa k teneis cerca del parc guell? porfa

Object

255Object21/06/2002 10:35:33

¿Tú que opinas sobre los niños estos del 3º mundo que no tienen ni para comer?Tu que ahora eres rico, ¿apadrinarías a un niño para toda la vida?

Object

256Object21/06/2002 10:36:00

Hola David, quiero decirte que me gusta muchisimo tu disco, es muy bueno en especial la cancion "No soy un superman" y "Cantabria" porque se lo que significa tu tierra tan bella para ti, fui de visita y me gusto mucho!!!, quiero desearte muchos exitos y que salgas adelante como hasta ahora lo has hecho.. Cual es tu cancion preferida del disco?

Object

257Object21/06/2002 10:36:09

Hola soy chilena y me gustaría preguntarte ¿iniciaras una gira por sudamerica especialmente Chile?

Object

258Object21/06/2002 10:37:21

por k estas tan bueno campeon eres el mejor aun el dia q te vi estabas enfadado y fuiste un poco borde te quiero igual.besos de una chaval de santiago d compostela q te conocio en luar

Object

259Object21/06/2002 10:37:21

¿Cuánto te mide la polla (grosor y largo)?

Object

260Object21/06/2002 10:37:22

¿Realizarás una gira promocional por mi país Chile?

Object

261Object21/06/2002 10:37:51

¿Ligas mucho?

Object

262Object21/06/2002 10:38:27

David,¿q piensas q ocurrira cuando entren los nuevos concursantes a la academia?¿Ireis todos a darles consejos?¿que cambiarias de todo lo que ha ocurrido en estos seis meses?

Object

263Object21/06/2002 10:38:31

¿Eres virgen? si no lo eres, ¿a que edad dejaste la virginidad?

Object

264Object21/06/2002 10:39:08

hola David,en primer lugar te felicito por tu disco.Sabes si vas a venir a Valencia a firmar discos?Muhas gracias y espero inpaciente tu segundo trabajo!Besos.

Object

265Object21/06/2002 10:39:09

¿Piensas salir desnudo en alguna foto, para así poder ver tu cuerpazo al completo?

Object

266Object21/06/2002 10:39:13

hola, Bustamante ¿por casualidad no haras una gira por Fuerteventura verda? Es q t admiro muchisimo y m gustaria saberlo. Muchas gracias por leerla.Besos Mayte.

Object

267Object21/06/2002 10:41:36

hola guapisimo q tal?me gustaria saber cuantas copias llevas vendidas?eres el mejor!!!!!!

Object

268Object21/06/2002 10:41:51

veo el programa por el cable cuando vendras a chile te queremos mijito ricoooooo!!!!

Object

269Object21/06/2002 10:42:09

primero que nada debo de felicitarte y mandarte un beso y un abrazo desde Venezuela y mucha suerte en este nuevo sueño que emprendes, mi pregunta es la siguiente que aspiras conseguir trasmitir a ese publico que te apoyo con tus canciones?

Object

270Object21/06/2002 10:42:16

Hola David, ¿Puedes imaginarte, en este momento, que hubiera sido de tu vida si no hubieras entrado en la académia? ¿Cambiarías tú anterior "tranquilidad" de persona no conocida por la persona que eres hoy? ¿Añoras a tus amigos, tus amigas, tu familia ... tu pueblo? Si yo estuviera en tu lugar los añoraría mucho, pero sé que debes aprovechar al máximo esta grandísima ocasión, y no dejar escapar ni lo más mínimo. Enhorabuena por tu gran voz y aún más por tu gran corazón. Un beso. Lina Mascaró.

Object

271Object21/06/2002 10:42:19

¿Que sientes cuando ves a toda esa gente cantando tus canciones, llorando y emocionandose??

Object

272Object21/06/2002 10:42:19

BUSTA TE QUERÍA DECIR QUE ME GUSTA MUCHO TU DISCO Y NO SE CUAL ES LA CANCIÓN QUE MÁS ME GUSTA SON TODAS MUY BONITAS.TE QUERÍA PREGUNTAR UNA COSA¿CON QUE CANCIÓN DEL DISCO TE IDENTIFICARIAS MÁS?.ERES EL MEJOR ARTISTAZOOO

Object

273Object21/06/2002 10:43:02

No se si sera una pregunta un poco precipitada,pero me gustaria saber si ya tienes proyectos del proximo disco, gracias. Toñi

Object

274Object21/06/2002 10:43:05

hola, busta ante todo decirte que eres uno de mis preferidos al igual que vero por eso te queria preguntar que opinas acerca de que ella solo cante 25 minutos en los conciertos. Aun que es pero que para el lunes este arreglado. Bye guapeton y sige asi. cris_cartagena

Object

275Object21/06/2002 10:43:23

hola bustamante eres el mejor. Solo queria decirte q sigas asi, da igual q t digan q lloras mucho o cosas asi, es una manera de expresar tus sentimientos, y eso m gusta. Bueno, mi pregunta es si por casualidad haras una gira por Fuerteventura para ir a verte? y si asi es ire, no m la perdere por nada del mundo. Te lo juro. Siempre tu Fans Nº1 Mayte.

Object

276Object21/06/2002 10:45:28

HOLA BUSTA SOY TU FANS NÚMERO UNO ME GUSTA MUCHO COMO CANTAS.ERES EL MEJOR Y TE QUERÍA PREGUNTAR CUANDO VIENES A FIRMAR DISCOS A MADRID?TE QUIERO MUCHO ARTISTAZOOOOOOOOOOOO

Object

277Object21/06/2002 10:46:14

Hola Busta guapetón, mi pregunta es la siguiente: ¿vas a venir a Donosti aunque sea a firmar discos? Espero que sí... besos de tu fan Elba. Te quiero

Object

278Object21/06/2002 10:49:23

vas a dar un concietos en alguna ciudad de Castilla y Leon y en Aragon eres el mejor sigue asi una super fans. besos. PUCE

Object

279Object21/06/2002 10:50:54

hola david, me alegro mucho por tu exito y te voy a apoyar siempre. ¿Piensas que lo que te ha ocurrido es cuestion de suerte o que tenia que ser asi? Un beso, Tanya (Vitoria)

Object

280Object21/06/2002 10:51:26

¿todavia conservas un peluche de una flor que te tiraron en el concierto de elche? te la tire yo.eres el mejor

Object

281Object21/06/2002 10:51:36

como te mantienes para estar tan guapo? kathy de Republica Dominicana

Object

282Object21/06/2002 10:51:44

¿Piensas que lo que te ha pasado es cuestion de suerte o que tenia que ser asi? UN beso, Tanya (Vitoria)

Object

283Object21/06/2002 10:52:22

Array

Object

284Object21/06/2002 10:53:16

hola david.me gustaria saber con cual de las canciones de tu disco te sientes mas identificado;por cierto tu disco es maravilloso.

Object

285Object21/06/2002 10:53:37

Hola David. Me llamo Sara y escribo desde Austria. Mi pregunta es la siguiente: De que manera ha cambiado tu vida desde que saliste en Operacion Triunfo? Ya no solo en el profesional, sino tambien en el personal. MUCHAS GRACIAS; SARA

Object

286Object21/06/2002 10:54:17

Me gustaría saber cual es el regalo que nunca te han hecho y que te gustaria que te regalaran.Grisel (Asturias)

Object

287Object21/06/2002 10:54:21

Hola Dabid!Soy una chica de Toledo.Me llamo Silvia y quería felicitarte por lo que estás consiguiendo.Te lo mereces.Hasta dónde te gustaría llegar en el mundo de la música?También me gustaría saber cómo puedo pertenecer a tu club de fans?Un besito y te deseo todo lo mejor.Ciao!

Object

288Object21/06/2002 10:55:21

hola david.Mi pregunta es:como te ves de aqui en un futuro¿?yo espero poder tener muchos discos tuyos en casa.

Object

289Object21/06/2002 10:56:09

¿por qué no vienes a más provincias de Castilla y León, soy de Ávila y solo viene Rosa, y tu aquí tienes muchas fans.Piluca.Ávila

Object

290Object21/06/2002 10:56:12

la fama esta muy bien pero si pudieras cambiar algo de ella que seria?

Object

291Object21/06/2002 10:57:20

Hola David!!Soy Silvia,una chica de Barcelona.Queria felicitarte por ese gran disco y decirte que es de lo mejor que he escuchado.Me gustaria saber si al final cogeras un piso en Bcn o te iras a tu tierra a vivir.Muchas gracias.Eres el mejor,tk.Besos

Object

292Object21/06/2002 10:57:26

HOLA CAMPEON!!ANTES QUE NADA TE QUERIA FELICITAR POR TU DISCO¡¡ME ENCANTA!!ME ALEGRO MUCHO DE QUE HAYAS ELEGIDO A ALEX PARA HACER EL DUO EN TU DISCO,¡¡ES ESTUPENDO!!MI PREGUNTA ES: ¿NO PIENSA HACER NINGUN DUO MAS CON OTRO/A DE TUS COMPAÑEROS/AS EN UN FUTURO?. MUXOS BESZOS PARA TI Y TAMBIEN PARA ALEX. SOIS LOS MEJORES.MARIA, SALVATIERRA(BADAJOZ)

Object

293Object21/06/2002 10:57:56

HOLA DAVID BUSTAMANTE ME LLAMO LAURA TENGO 19 AÑOS Y SOY DE OVIEDO QUERIA PREGUNTARTE SI ALGUNA VEZ TE HAS ENAMORADO FUERTEMENTE DE ALGUIEN? UN BESITO Y HABER SI TE PASAS ALGUNA VEZ POR OVIEDO VECINITO TE QUIERO MUA.

Object

294Object21/06/2002 10:59:04

ALGUNA VEZ HAS ESTADO ENAMORADO DE ALGUIEN FUERTEMENTE? BESITOS LAURA OVIEDO

Object

295Object21/06/2002 10:59:59

HOLA ENCANTO!!QUE TAL?COMO LLEVAS TODO ESTO DE LA FAMA? QUE ES A LO QUE MAS TE CUESTA ACOSTUMBRARTE?NO CAMBIES NUNCA ERES UN CIELO Y TE QUIERO MUCHISIMO.MAYCA,SALVATIERRA (BADAJOZ)

Object

296Object21/06/2002 11:00:38

¿Qué hacía tal día como hoy hace un año? Y en la actualidad ¿Qúe es lo primero que piensas al levantarse?

Object

297Object21/06/2002 11:01:00

¡hola guapisimo! Me llamo Mª Jose y me gustaria darte las gracias yo a ti por ese peazo de disco que has echo, es precioso. Tambien me gustaria que nos contaras cómo va a ser un concierto de tu gira con Vero. Os espero a los dos en Benidorm. Mucha suerte y un besazo corazón, UNA FAN

Object

298Object21/06/2002 11:01:06

Lo primero, GRACIAS por contestar a la carta q te di en el concierto. Mi pregunta es:¿vendras a San Sebastián despues de tu gira? Me gustaría mucho poder agradecerte todo lo que haces por nosotr@s. Mucha gente te espera aquí.Un beso muy fuerte.UXUE.

Object

299Object21/06/2002 11:03:05

hola david que sepas que eres mi idolo number one y que sepas que cantas que te cagas,¿vas a venir a la cubierta de leganes a hacer un concierto? te quiero y tengo tu cd un besazo Jesi de madrid (Leganes) 16 años

Object

300Object21/06/2002 11:03:18

El publico te adora y con tu primer disco has demostrado que no llegaste a la final como muchos pensaban solo por idolo de adolescentes....estas contento con el resultado obtenido de ventas y con la reaccion del publico en general con tu trabajo?

Object

301Object21/06/2002 11:03:44

hola guapo!eres el mejó, pero me gustaria saber si en la gira nada mas vas a ir con `la' vero, o vas a ir con alex, o gisela ,ya qe teneis canciones juntos. ah me encanta tu disco.ptri de malaga, y qe sepas qe me fui a las 5:30 de la mañana pa hace cola solo pa verte a ti, pero merecio la pena.adios guapeton

Object

302Object21/06/2002 11:03:59

me encanta tu disco, no se si te acordaras de mi soy la de la camparta al reves del segundo concierto de madrid. me gustaria saber que te parecio?. la hice con mucho cariño para ti, espero qque te haya gustado. por cnt.

Object

303Object21/06/2002 11:04:41

Hola David,¿al entrar en la Academia,en que posición te situaaste ante los demás compañeros? ¿Sigues sin creerte lo de tu primer disco?Está muy bien.Dani Virum

Object

304Object21/06/2002 11:05:36

Bustamante , soy una gran admiradora tuya y me gustaría saber si haces un concierto a palau o cerca d figueras ,o bien , si vas a un hotel en Roses .me encantaría verte cantar o verte en persona , muxos besos.anna

Object

305Object21/06/2002 11:05:55

bustamante eres el mejor podias venir a cantar a Valladolid ahora hay que ir al disco de diamante un besos una de tus fans PUCE

Object

306Object21/06/2002 11:07:08

que fue lo mas dificil que te toco hacer en o.t?? y porque ?? a cual de tus compis te parece mas sincero y el que va triunfar donde se pare ??? porque eres tan buenazo!!!!!!???? te amo!!!!!!!michelle me gusta tu sensibilidad

Object

307Object21/06/2002 11:07:45

Hola Busta, me encantas, solo queria hacerte una pregunta, ¿con cual de las canciones de ese pedazo de disco que has hecho, te sientes mas identificado? Un besazo. Rocío.TQM

Object

308Object21/06/2002 11:08:24

Hola, busta, pues primero te quiero felicitar por tu CD, y por tu sencilles como persona, eres super guapo, y te deseo todo el exito del mundo. Soy de la pequeña isla de Rep. Dominicana en el caribe, y desde aqui seguimos OT, y tu trayectoria. Ojala algun dia podamos dsifrutar en vivo de tu linda voz y pues verte en persona. Un beso grande y pues exitos....Gina Saleta, tu fan # 1 de Santo Domingo, R.D.

Object

309Object21/06/2002 11:08:51

Hola me gustaria saber q conciertos haras en galicia.eres el mejor.un beso

Object

310Object21/06/2002 11:09:20

David, te envío un gran saludo desde Chile, País en el confin del mundo. Seguimos por la señal internacional de TVE tu participación en OT y fue excelente. Suerte en todo lo que emprendas en la vida. Patricio Ramírez M. Santiago de Chile 21/06/2002

Object

311Object21/06/2002 11:09:35

Hola Busta, me gustaria saber si los peluches y cartas que os tiramos en los conciertos os los quedais vosotros o no.Me encanta tu disco y me encantas tu. Un besazo.Rocío

Object

312Object21/06/2002 11:09:54

¡Hola wuapeton!!cuando vas a venir a Valencia la tierra de las flores jeje la mejor a firmar???dimelo xfa es pa no perdermelo TE KIERO CONOCER!!!

Object

313Object21/06/2002 11:10:02

Hola David te saluda una admiradora desde Houston, quiero saber si tienes planes de venir pronto ya sea a Estados Unidos o Mexico? Besos se tequiero mucho y se te admira Hasta pronto

Object

314Object21/06/2002 11:10:50

Ola David , primero kiero felicitarte por tu disco , y me gustaría preguntarte ¿kómo te sientes al haber vendido más de medio millón de copias en tan poko tiempo?anna d ROSES

Object

315Object21/06/2002 11:11:08

Hola david seguramente mucha gente te dira k eres el mejor, pero sin duda lo eres. Tu evolución ha sido muy buena. Eres una persona muy agradable el sabado te fui a ver al corte de las palmas pero la multitud no me dejaba verte, espero k no sea la ulitima ocasion k tenga para verte y k vuelvas pronto. un besazo muy grande. CATHAYSA.

Object

316Object21/06/2002 11:11:15

Pensaras al terminar tu gira de verano en España venir a suramerica?

Object

317Object21/06/2002 11:11:32

hola bustamante!!!!!!!!!!!!!!; cantas como un angel eres el mejor. yo te queria preguntar si tu paso por la academia te ha cambiado la manera de ser? adios eres el mejor sigue asi!!!!!!!! sonia barcelona

Object

318Object21/06/2002 11:11:48

con tantos amigos catalanes, ya vas entendiendo algo de catalan?? suerte en todo!!! aloma-

Object

319Object21/06/2002 11:12:23

Ahora q eres famoso,¿podrias ayudar a mi hermana que no ha podido tener la oportunidad de demostrar lo bien que canta por causas ajenas a ella?(No quiero aprovecharme de ti, sólo te estoy diciendo la verdad.)GRACIAS.Ojalá sigas siempre igual.UXUE de San Sebastián

Object

320Object21/06/2002 11:15:23

¿Es verdad q te declaraste a Gisela y ella t rechazo?Janire(laredo)

Object

321Object21/06/2002 11:15:44

HOLA BUSTA MI PREGUNTA ES MUY SENCILLA ORDENA DE MAYOR A MENOR SEGUN TE CAIGAN LOS DE OPERACION TRIUNFO

Object

322Object21/06/2002 11:16:17

porque no vas a venir a san sebastian de gira?no te vas a pasar por el pais vasco?

Object

323Object21/06/2002 11:17:13

no vas a venir de gira a el pais vasco? te pasas por todos los lados excepto por aki

Object

324Object21/06/2002 11:17:51

David en Venezuela tienes muchas fans que nos encanta como cantas y como eres, crees que proximamente puedas venir a nuestro paìs

Object

325Object21/06/2002 11:19:16

no vas a venir de gira a san sebastian???porfavor pasate por aki... aki te keremos mucho mucho y mucho......... eres el mejor te kiero

Object

326Object21/06/2002 11:19:34

David en Venezuela tienes muchas fans que te amamos, ¿crees que es posible que vengas a nuestro país proximamente?

Object

327Object21/06/2002 11:19:37

hola guapisimo q tal?cuantas cosasme gustaria preguntarte y ahora q tendgo la oportunidad no se me ocurre ninguna ¿cuantas copias llevas vendidas?me han dicho q 1.500.000 es verdad?eres el mejor AUPA BUSTAMANTE!!!!!y como tu dices en el foro besos dulces y traviesos

Object

328Object21/06/2002 11:19:53

bustamante,¿por que no vienes de gira aki de ceuta? soy tu fan nº 1 por favor mandame la respuesta (de yolanda)

Object

329Object21/06/2002 11:20:09

wolaa! soy una super fan uya katalana!!! te queria hacer una pregunta xq no actuas + dias, y en + lugares aki en kataluña? kantos dies staras en roda de vera (tarragona)? piensa k ay mucha gente k haria lo q fuera xa hablar o nadamas verte! eres el mejor!!! Y PORFAVOR HAZME UN GRAN FAVOR! NO CANVIES NUNCA TU FORMA DE SER!!!! XK TODAS TE KEREMOS ASI, KOMO TU ERES!!!! a-10 wapeton! deseo kon todas mis feurzas k lo puedas leer y a ser posible kontestarme(ya se k tienes mucho trabajo, xo si nunca tienes un ratito y te akuerdas d mi...), ya sabes! mi direccion d korreo s: martajs4@hotmail.com :)))))))))))))) viva tu viva àlex casademunt viva cantabria visca catalunya! y a ser posible viva yo! jajajaja :) :p :D ;P xD

Object

330Object21/06/2002 11:20:15

david cuando vas a venir a firmar a madrid tengo muchas ganas de conocerteen pesona yo soy una fans tuya de madrid te quiero muchisimo david espero pronto darte un beso muy gordo yo me llamo mari carmen tengo 30años TE QUIERO DAVID MUCHOS BESOS GORDOS

Object

331Object21/06/2002 11:20:24

hola david: yo soy una cordobesa que te quiere mucho. ¿cual es la cancion que te gusta mas de tu disco? a mi me gustan toooodaas.ana. besos.

Object

332Object21/06/2002 11:20:30

Hola David!!!!!!! Soy Rosana. Primero de todo te

Object

333Object21/06/2002 11:20:40

¿crees que has cambiado desde que entraste en la academia? Espero q nunca cambies y q te pases algun dia por Bilbo

Object

334Object21/06/2002 11:20:54

David, como crees ue sera tu gira, como nos comportaremos tus fans? y crees que es muy positivo para tu carrera todo el apoyo k te estamos dando tus fans?

Object

335Object21/06/2002 11:21:34

¿Crees que con todas estas fans que tienes, algun dia te sentiras agobiado y te iras a vivir fuera de España, como por ejemplo a Miami?(Por favor no, gracias)

Object

336Object21/06/2002 11:21:42

David, una pregunta clásica: ¿Salud, dinero o amor?

Object

337Object21/06/2002 11:22:22

hola david: soy una cordobesa super fans tuya.¿cuál es la canción de tu disco que te gusta un poco mas? a mi me gustan toooooodaaaaaas. ana. besos.

Object

338Object21/06/2002 11:22:59

wolassss!!!!!!! me llamo marta, soy d barcelona! te keria preguntar, si vas a signar diskos en algun centro comercial? kando? kon kien? ya lo as hecho? porfavor! kontesta! eres el mejorr! y hazme un favor NO CANVIES NUNCA, y ayuda al ÀLEX CASADAMUNT si puedes!! el tambien se merece triunfar = k tu! dews graciessssssss :)))))))))))

Object

339Object21/06/2002 11:23:09

holaaa compañeruu¡¡ ahi va mi pregunta: ¿Eres consciente de todo lo que está pasando a tu alrededor en lo referente a las ventas de tu 1er cd? asias compañero soy del foro WENAGE (fran desde Sevilla)

Object

340Object21/06/2002 11:23:13

hola david¿qe tal llevas esto de ser famoso?, y de haber vendido mas de 500.000 mil copias en tres dias. eso tiene qe se "increible",y qe pensastes cuando tuvisteis el ultimo concierto?eres el mejo(patri de_malaga)

Object

341Object21/06/2002 11:23:49

Hola David, me llamo Alba. Desearía poder decirte muchas cosas, pero no creo tener el espacio necesario para hacerlo. Mi pregunta es muy sencilla: ¿Qué sientes al ver que hay tanta gente que lo da todo por ti, y que te quiere y te apoya tanto (ahí me incluyo yo)? Tu disco es fantástico, en todos los sentidos. Todos los temas son buenos, y se ve por la forma de cantar que pusiste el alma y el corazón. En serio, da gusto oírlo. Muchos besos; eres especial y lo serás siempre. Te quiere, Alba.

Object

342Object21/06/2002 11:24:04

Hola Bustamante mi nombre es Linette y soy de Panamà; querìa saber si vas a hacer gira internacional junto con tus compañeros ya que aquì en Panamà operaciòn triunfo esta teniendo un èxito rotundo y la verdad me encantarìa que vinieràn a Panamà ya que soy super fans de ustedes en especial tuya, de rosa y de nuria fergò y que no se quede por fuera bisbal.... muchas gracias por dejarme entrar en este espacio suerte a todos y espero verles pronto adiòssssssssssssssss

Object

343Object21/06/2002 11:24:17

Hola David!!!!!!! Soy Rosana. Primero de todo te quiero felicitar por tu GRAN disco, eres todo un ARTISTAZO. Mi pregunta es: cúando vas a promocionar el disco por Sud América?. Un beso y gracias por todas las visitas que nos haces al foro. No cambies nunca, eres el Mejor.

Object

344Object21/06/2002 11:24:29

Hola David!Como se siente una persona encima de un escenario y sintiendo como millones de personas cantan sus canciones y gritan su nombre a la vez?Te admiro y me encantaria poder cantar algun dia contigo.Tu ilusión,tambien es mi ilusión.Pero quizá lo mio sea más dificil ya que voy en una silla de ruedas y es un poco mas complicado. Un beso de una chica encantada por tu persona. Cris. Barcelona.

Object

345Object21/06/2002 11:25:46

querido compañero David: ¿Sigues siendo el mismo chaval que entro en la academia? WENAGE (foro DAvid Bustamante)

Object

346Object21/06/2002 11:26:45

¿Qué sentiste el día en que te eligieron tercer finalista del programa? Fue precioso, de veras. Besos, Yuna.

Object

347Object21/06/2002 11:27:37

hola artistazo¡¡¿Esa pedazo de voz que tienes es un don o la has educado desde pequeño?por favor nunca abandones....seria un pecado para nuestros oidos no disfrutar de esa maravillosa voz que nos hace estremecer.un beso. ANA ISABEL -LA CORUÑA-

Object

348Object21/06/2002 11:28:33

hola bustamante,creo que eres un chico guapisimo y q cantas divinamente.crees q españa va a ganar el mundial? muxoooooos besoooooos

Object

349Object21/06/2002 11:28:48

Hola guapo!ahi va mi pregunta:si tuvieras k deslumbrar a alguien con tus ojos ¿kien seria la afortunada? TE KIERE MUXO VANESSA

Object

350Object21/06/2002 11:29:12

hola David soy WENAGE del foro: ¿Crees que se ha cometido una injusticia en la promoción de tu cd? Se sincero.Eres para nosotros el mejor te lo dicen Fran y Lola desde Sevilla,un matrimonio joven de Sevilla.

Object

351Object21/06/2002 11:29:22

Más que una pregunta es un comentario, soy de Ecuador y aqui transmiten por un canal nacional" Operación Trinfo" están transmitiendo aquí la 8 gala, y quiero decirte que es el programa de mayor audiencia y también han creado un programa similar aqui, pero de todos tú eres nuestro favorito por la sencilles que expresas cuando cantas, ries, lloras y miras. Quiero decirte que sigas adelante porque alguién como tú se merece estar ahí. Diana Rosero

Object

352Object21/06/2002 11:31:15

¿Cómo crees que te sentirás cuando escribas tu primera canción y además la interpretes en lo alto de un escenario?

Object

353Object21/06/2002 11:31:30

hola soy una fan tuya de merida,todavia estoy sin habla desde el concierto y me gustaria conocerte aunque no pudiese.mi nombre es marta.¿cuando vas a venir a conocerme?muchos besos guapeton y que no cambies

Object

354Object21/06/2002 11:31:59

q opinas sobre la pirateria? muxisimos besos mua

Object

355Object21/06/2002 11:32:08

hola david,soy un gran fan tuyo de trece años.soy de merida(donde actuastes con tus compañeros)espero q por alñguna casualidad nos podamos ver algun dia.adios¡¡¡¡sigue asi!!!!

Object

356Object21/06/2002 11:32:50

¿despues de las galas del verano no debias hacer una pausa y seguir formandote musicalmente?

Object

357Object21/06/2002 11:33:25

¿Cómo crees que te sentirás cuando escribas tu primera canción y además la interpretes en lo alto de un escenario?.Letizia.Madrid

Object

358Object21/06/2002 11:34:19

DAVID HOLA SOY DE MEXICO Y ME GUSTARIA SABER CUANDO VAS HA ESTAR DE PROMOCION AQUI EN MEXICO. TE MANDO BESOS Y ABRAZOS

Object

359Object21/06/2002 11:34:49

¿Cómo crees que te sentirás cuando escribas tu primera canción y además la interpretes encima de un escenario?Letizia.Madrid.

Object

360Object21/06/2002 11:34:49

Busty... en mi pais estan por realizar un programa estilo OT, al cual yo he querido asistir a los castings, porque tu me inspiras muchisimo solo que tengo una preguntita ¿ como hiciste con los nervios, porque la verdad es que matan? Y por otro lado decirte que en mi pais Venezuela son todos los de OT idolos; ¿ como asumes que tu pasaste de ser de San Vicente de la Barquera para toditita España y ahora practicamente le perteneces a parte de este lado del mundo donde tu espontaneidad, talento, voz y simpatia deleitan por su calidad? "Asi que Bustamante disco de Diamante"... Exito, Salud y Besitos desde Venezuela se te quiere Mariangeles Valenzuela

Object

361Object21/06/2002 11:35:33

Hola! Ante todo felicidades por ese gran disco. La verdad es que no me esperaba menos. Tuve la oportunidad de verte en una gala y es sorprendente las cualidades que tienes. A pesar de haber cumplido tu sueño, ¿qué es lo que te resulta más dificil de esta nueva vida que te ha tocado vivir? Un besazo y muchas suerte. Patricia (Barcelona)

Object

362Object21/06/2002 11:36:03

Desde Venezuela recibe un gran abrazo David. Mi nombre es Francis Bonilla, soy periodista venezolana. Quisiera saber ¿Qué expectativas tienes con la gira que empezarás en solitario?¿Cómo opinión tienes acerca del mercado musical Latinoamericano? y ¿Cómo ves tu entrada como cantante en países como México y Venezuela?

Object

363Object21/06/2002 11:37:28

BUSTA ¿QUE SIENTES AL SABER QUE AHORA MUCHOS JOVENES COMO TU SE FIJAN EN TI COMO UN EJEMPLO A SEGUIR DE ESFURTZO Y SUPERACION EN LA VIDA DIRIA? UN saludo tan grande como tu corazon de israel teran romano de santander , cantabria.

Object

364Object21/06/2002 11:40:27

¿Qué canción de tu disco es la que más te gusta y a la que tienes más cariño?OLExBUSTA y merlu14.Un besazo guapo.

Object

365Object21/06/2002 11:41:32

HOLA DAVID. ME HUBIESE GUSTADO Q HUBIESES VENIDO A JAÉN CAPITAL PARA PODER IR A VERTE, AUNQUE PIENSO IR A MARTOS. PERO SI HUBIESES ESTADO AQUI PUES HUBIESE HECHO LO IMPENSABLE PARA PODERTE CONOCER. MUXOS BESOS DE UNA GRAN FAN. Q TE QUIERE MUXISIMO. ¿VENDRAS EN OCTUBRE PA LA FERIA?

Object

366Object21/06/2002 11:41:45

¿Que canción de tu disco es la que más te gusta y a la que le tienes más cariño?OLExBUSTA y merlu14.Un besazo guapo.

Object

367Object21/06/2002 11:42:19

hola busta m gustas mucho y espero verte en mi pueblo ya que vendras por la gira d verano eres muy guapo dime algo.un besazo

Object

368Object21/06/2002 11:43:10

ahora que ya eres uno de los pocos cantantes españoles con más de 1.000.000 de copias vendidas de tu primer album, ¿crees que en proximos trabajos seguiras teniendo el mismo éxito o que es algo que algún día se acabará?. aunque tengo que decirte que para mi eres uno de los mejores cantantes del momento. muchas gracias y mucha suerte. Demelsa

Object

369Object21/06/2002 11:44:21

hola david, soy janet una xica de 14 años de vitoria y loca por ti!!! siempre pienso en ti, cuando me stabn curando una herida pensaba enti cuando estudiaba pensab en ti.bueno y esta es mi pregunta. ¿por q no vienes al pais vasco ha ahcer conciertos?? me gustaria muxo poder verte en concierto aunque ya te vi en concierto con todods los demas pero no es lo mismo.besos.y q tengas muxo exito aunque ya lo tienes por q te lo mereces JANET LOVES BUSTA

Object

370Object21/06/2002 11:44:28

hola busta soy nadia una chica asturiana de 17 años.¿que es lo que menos te gusta de todo este sueño que vives, por supuesto,porque te lo has currado?.Aqui te qeremos mucho.Ven pronto.muchos besos.gracias.

Object

371Object21/06/2002 11:46:00

HOLA HERMOSO QUIERO SABER SI TU ESTARAS PRESENTE EN OPERACION TRIUNFO DE MEXICO POR QUE SOLO ME VOY A INSCRIBIR PARA CONOCERTE SOY DENISSE OCAMPO DE MEXICO .TE MANDO MI CORREO POR QUE NO SE CUAL ES EL TUYO . CLAUDIA_MAGO@YAHOO.COM.MX TE RUEGO ME RESPONDAS Y TE LO AGRDESCO MUCHO MUCHO SI LO HACES TE MANDO MIL BESOS ERES UN GUAPO GRACIAS

Object

372Object21/06/2002 11:47:02

ahora que ya eres uno de los pocos cantantes españoles con más de 1.000.000 de copias vendidas de tu primer album en menos de un mes, ¿crees que en proximos trabajos seguiras teniendo el mismo éxito o que es algo que algún día se acabará?. aunque tengo que decirte que para mi eres uno de los mejores cantantes del momento. muchas gracias y mucha suerte. Demelsa

Object

373Object21/06/2002 11:47:36

¿si tuviera algien un disco tuyo pirateado?¿que harias?con esto no significa que yo lo tenga besazos de joana,jessiy jenni

Object

374Object21/06/2002 11:48:59

David, después de tu experiencia cinematográfica, ves nuevos horizontes para tu carrera profesional?Besazo, Mar.

Object

375Object21/06/2002 11:49:06

DESDE PANAMA! Querido David: En Panamá eres una persona muy polular Sabias que no solamente en España eres tan famoso?

Object

376Object21/06/2002 11:49:35

que podemos encontrar dentro de tu disco? si hay muchas baladas,con ritmo etc.Y si hay muchas fotos.

Object

377Object21/06/2002 11:50:24

Hola David soy fan tuya y me gustaria que me contestaras esta pregunta te gusta gisela no digas mentiras

Object

378Object21/06/2002 11:51:34

¿Habrá un concierto en Barcelona? ¡¡¡¡¡¡¡ Eres el mejor !!!!!!!!!!!!!!!! GUAPO!!!!!!!1111

Object

379Object21/06/2002 11:53:26

Hola Busta!Eres genial.Mi pregunta es esta ¿Que sentiste cuando te dijeron que habias conseguido cinco discos de platino?Te quiere una fan tuya: Vanessa

Object

380Object21/06/2002 11:56:07

¿Qué tal esta el cántabro mas guapo de españa? Me llamo Mª Jose y quiero que sepas que tu disco es un regalo del cielo y que te deseo la mejor suerte del mundo. Me gustaria saber como va a ser un concierto de tu gira coin Vero. Ah! Enhorabuena por la gala desde Cantabria, fue muy bonita. Os espero en Benidorm, UNA FAN.

Object

381Object21/06/2002 11:58:44

Hola bustamante, soy una fan catalana tuya y me gustaria saber cuando vendras por Barcelona a firmar discos, que tengo muchas ganas ya de verte pronto.Un beso

Object

382Object22/06/2002 12:01:00

bustamante,crees q bisbal tiene mas seguidoras q tu??(como te lo tomas)

Object

383Object22/06/2002 12:02:08

Soy una fan de Bustamante desde que lo escuché cantar por primera vez y quería desearle lo mejor para esa carrera en solitario que ahora comienza y de la cual extraerá los mejores frutos. Mi pregunta es ¿porqué no se hizo el dúo previsto con Sergio Dalma?: creo que la canción "Dos hombres y un destino" fue escrita para cantarla con él. Nada más, un beso muy grande y una opinión personal "no hubieras necesitado las fotos para vender tu disco, pero gracias por el regalo".

Object

384Object22/06/2002 12:03:08

Hola Bustamante,una de mis preguntas de las muchas que te haria es que por qué solo haces un concierto en la provincia de Barcelona? Me gustaria que vinieras mas por mi tierra.

Object

385Object22/06/2002 12:03:36

¿CUANDO FIRMARAS DISCOS EN SANTANDER? DE MAITE

Object

386Object22/06/2002 12:03:39

DEBO DECIR ANTES DE NADA QUE TIENES UNA VOZ ENCANTADORA Y ME FASCINAS; Y HAS PENSADO EN SALIR FUERA DE TU PAIS A PROMOCIONAR EL DISCO O HACERTE CONOCER MAS YA QUE OPERACION TRIUNFO SALIO AL AIRE EN VARIOS PAISES Y HAN PEGADO FUERTE AL MENOS EN MI PAIS ECUADOR, ALGUN DIA TE TENDREMOS POR AQUI?

Object

387Object22/06/2002 12:06:33

en panama ha tenido mucho exito este programa, el paso por la academia, me gustaria saber si esta dentro de tus planes hacer una gira por mi pais o centro y latinoamerica

Object

388Object22/06/2002 12:07:43

Cuando tienes pensado venir a tenerife y si es posible al sur, ya que muchisima gente nos quedamos con las ganas de poder ir a veros,pues las entradas tan solo las vendian en el Corte Ingles en Santa Cruz y para los que vivimos en el sur fue un palo enorme, pues yo era de las que hubiera hecho 90 Km por ir a veros y eso que yo soy una madre con 48 tacos. En casa estamos todos locos con los 16 ,y vamos comprando todos vuestros discos ORIGINALES,( por cierto nos habeis hecho entender que con la pirateria, que por cierto es mucho mas barata, os perjudicamos mucho a los cantantes y dependeis de nuestras compras para poder continuar en el mundo de la musica )Lo que no entendemos es como hay gente, otros artistas, que os achacan el perjudicarles, yo creo que con vuestro carisma y ternura habeis conseguido tener a toda la familia pendiente de la tele en la misma cadena y de nuevo que la musica sea importante,. me encanto el programa del martes pasado, yo soy de las que tambien apuesta por el duo Bustamente y Gisela me encantais, y me gustaria que hicierais como Bisbal y Chenoa que han proyectado varios conciertos juntos. Enfin toda la suerte del mundo en este dificil camino que has elegido y que tu Virgen de San Vicente de la Barquera te cuide. por cierto es precioso,te prometo que si sigues siendo igual de accesible tendras en mi una de tus mayores fans y pondre mi granmito de arena comprando todos los discos que edites.Carmen Torres

Object

389Object22/06/2002 12:08:00

enmi pais panama ha tenido un gran exito operacion triunfo, tienes pensado hacer una gira de promocion por mi pais

Object

390Object22/06/2002 12:10:13

Te considero un artista y deseo que puedas vivir de la musica, que es lo que a ti tanto te gusta, porque vales y te lo mereces. ¿Que te parecen los comentarios de la gente, incluidos profesionales de la música, de que durareis muy poco?

Object

391Object22/06/2002 12:10:41

Hola David!! Primero enhorabuena por tu disco, es estupendo!! Mi pregunta es muy sencilla y a la vez complicada creo yo, si tuvieras que elegir una única canción de tu CD ¿con cuál te quedarías? ¿Por qué?

Object

392Object22/06/2002 12:11:16

Me llamo Virginia y soy de Uruguay ¿tenés algún plan o te gustaría hacer giras por latinoamerica?,me gustarìa pila ya que acá te queremos mucho.Te admiro mucho y cada vez que te escucho no puedo evitar emocionarme. Besos.

Object

393Object22/06/2002 12:13:14

Oye David Cuando Vendras a Latinoamerica ? De Venir no dejes de anotar a Venezuela en tu Gira... En Venezuela te Queremos y te deceamos todo lo mejor del mundo... Sigue Adelante. y qe Dios te Bendiga Siempre todos los dis de tu vida Hasta el Fin del Mundo...

Object

394Object22/06/2002 12:13:24

¿porque vas a hacer la gira con veronica?

Object

395Object22/06/2002 12:14:40

Hola David, mira te felicito, eres un artista completo. Me gustaria saber cuando vas a visitar Costa Rica? Un beso, chao Ivannia Peña

Object

396Object22/06/2002 12:14:44

como te sientes al saber k eres el deseo de muchas chicas?

Object

397Object22/06/2002 12:15:07

Hola David!! Lo primero felicitarte por tu CD que es genial. Ahí va mi pregunta:¿Te ves en un futuro componiendo tus propias canciones? Mónica (Vigo)

Object

398Object22/06/2002 12:15:29

David que te Gustaria Ser .Guapo o Inteligente? (Venezuela)

Object

399Object22/06/2002 12:15:55

te podrias enamorar de una chica?

Object

400Object22/06/2002 12:16:14

keria decir FAN

Object

401Object22/06/2002 12:17:12

David Cual es la Esencia de ser Hombre y Guapo a la vez..? (Venezuela)

Object

402Object22/06/2002 12:18:09

¿cuando vas a grabar el videoclip de tu nuevo single ,"el aire que me das!"?

Object

403Object22/06/2002 12:18:31

Somos Virginia y Alejandra de Uruguay. ¿Cuándo estás en un concierto qué es lo que más te emociona? Besos Titín.Le agradecemos a Dios por tú voz que nos llega al corazón.

Object

404Object22/06/2002 12:18:52

Hola David!! ¿Cómo te gustaría q te recordaran dentro de 50 años? Enhorabuena por tu CD. Mónica (Vigo)

Object

405Object22/06/2002 12:19:02

David donde te Gustaria Hacer el Amor en La Playa, Rio,o la Montaña.? (Venezuela)

Object

406Object22/06/2002 12:19:16

vas a venir a Guayaquil-Ecuador?

Object

407Object22/06/2002 12:19:37

david soy venezolana y quisiera saber cuando tendremos el gusto de tenerte en este pais.besos tu admiradora

Object

408Object22/06/2002 12:21:18

David tu Manera de ser, es Espontanea o es Pura Apariencia..? (Venezuela)

Object

409Object22/06/2002 12:21:57

Hola Bustamante soy Marian una fan de Cuenca me gusta mucho tu disco y que me gusta mucho el duo artistico con Veronica porque vuestras voces son geniales,a ver si haces un hueco en tu agenda y haceis los dos un concierto en Cuenca, porfavor,un beso y Viva Busta: Marian

Object

410Object22/06/2002 12:22:24

hola soy susana y no he superado el segundo casting q se siente habiendo conseguido hacer lo que uno mas desea: CANTAR Y SENTIR CANTANDO.SUSANA MONTGAT

Object

411Object22/06/2002 12:22:44

Hola David, paisanuco, ¿no te preocupa que tu imagen sea sociada sólo con seguidor@s jóvenes y que esto pueda influir en el tipo de música que hagas? Has de saber que las teintañeras, y mayores, tambien te seguimos y te apoyamos. Un beso. Angela

Object

412Object22/06/2002 12:23:27

David si te Dijeran que hoy es el Ultimo dia del Mundo Que Arias...? (Venezuela)

Object

413Object22/06/2002 12:23:31

espero que saques mas discos xq te lo mereces eres un campeón¡¡¡¡¡¡ y te lo has currao¡¡¡ TU SI Q VALES¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

Object

414Object22/06/2002 12:24:42

hola busta!!!! no sabes lo que te kiero!!!! solo ...preguntarte si..... tienes novia ????? si no tienes mandale a tu fan numero 1 un mensaje:mprietolorente @hotmail.com tengo toda mi hbitacion llena de poster tuyos y tng tus calcetines , cramlos,fotos,y crpeta...¡ah! tus hermnosss stan wuenisimossssss sobre todo igor!!!! besos : una catalana lokita por ti ..... MAR

Object

415Object22/06/2002 12:26:38

hola Busta mi nombre es Duvra soy de Venezuela queria saber cuando vendras aqui a visitarno ya que tienes muchos fnas? vesos guapo!!!!!!! PD: Bustamante sera disco de diamante!!!!!! :)

Object

416Object22/06/2002 12:28:12

Hola!!!!!!!!!Busti, soy Samantha de PERU, quiero que sepas que desde aqui hemos seguido OT y nos a gustado mucho, Cuando estaras promocionando tu disco por latinoamerica y en especial por Peru?? Un beso corazon, cuidate mucho y sigue asi

Object

417Object22/06/2002 12:28:38

hola Busta mi nombre es Duvra soy de Venezuela quería saber cuando vendrás aquí a visitarnos ya que tienes muchos fnas? besos guapo!!!!!!! PD: Bustamante será disco de diamante!!!!!! :)

Object

418Object22/06/2002 12:29:38

hola david!!!, mi nombre es consuelo villanueva y soy CHILENA, y por estos lados vengo siguiendo tu carrera como cantante, mi pregunta es la sgte : Ahora que has realizado tu sueño, ¿cúal es tu próximo sueño a cumplir?, te quiero mucho y mucha suerte.

Object

419Object22/06/2002 12:33:31

Hola Busta!!Me llamo Sheila.Soy una fan numero 1 tuya.Me gusta mucho tu disco y estoy prguntando mucho aver cuando vas a venir a bcn a firmar discos!!Eres mu guapo y cantas mu bien.SIGUE ASI ERES EL MEJOR!!.BESOS

Object

420Object22/06/2002 12:40:31

Hola guapetón! Q es lo q más has aprendido en todo este tiempo?Y lo q más te gusta y agradeces y a quién?Eres el mejor. No cambies.Te keremos.Un beso.Maia

Object

421Object22/06/2002 12:40:45

bueno a parte de decir ke es un gran artista y ke a llegado al corazon de todo el mio y sobre todo el mio me gustaria preguntarle ¿ k se siente ahora de ver ke me a exo llorar cuando yo lo e visto, no solo yo sino mas de un millon de personas pero k no an consegido abrazarte ni conseguir un autografo? k les diria a esta gente ke se muere por abrazarleo k le mire a los ojos, porke es un pedazo de artisa.un besazo Laurita Roca se Mallorca, te mereces esto y muxo mas.

Object

422Object22/06/2002 12:41:23

Hola David, es cierto lo que andas con GISELA???????????????????

Object

423Object22/06/2002 12:45:46

Mas que preguntar es un saludo desde Puerto Ordaz, Venezuela hemos visto su friunfo a travès de Televiòn Española (TVE), felicitaciones y continua por este rumbo al cual te has en rumbado, eres muy buen ejemplo de superaciòn para todos los jòvenes de tu paìs y de otros paises que pudimos disfrutar ese logro tan anelado por todos los jòvenes que tenemos sueños a travès de Satèlites (TVE), es por esto que le pido Dìos Bendito que pronto transmitieras ese optimismo a todos los jòveness de mi gran paìs VENEZUELA. PD.¿ Cuando se espera verle por Venezuela? Saludos.... Pa' Tras ni para cojer impulsos.!!! Atentamente; Alexis A. Gonzàlez PuertO Ordaz, Edo. Bolìvar, Venezuela Email: caciquepuro@hotmail.com

Object

424Object22/06/2002 12:46:34

Eres cosciente david Bustamante de la cantidad de discos que as vendido??? sabrias decir cuantos??? sigue asi Busta que eres el mejor

Object

425Object22/06/2002 12:47:10

busta soy la xika del aeropuerto q estaba tan histerica perdoname,eres el mejor!!cuando vienes a firmar a madrid??xq abeis cancelao dos conciertos??t.q.m!!_eLeNa_

Object

426Object22/06/2002 12:47:19

¿Que te parece la acogida que te estamos dando los canariones en estos dias que has pasado entre nosotros? ¿te gusta nuestra isla? Espero que tanto como tu a nosotros/as. Mariola. Las Palmas de G.C. Un beso y suerte en tu carrera que durará años.

Object

427Object22/06/2002 12:49:37

Hola busta, soy ecuatoriana y quiero decirte que me encantas! al igual que a muchas aqui. Mi pregunta es ¿Que se siente saber que en varios paises del mundo estan gritando tu nombre y te adoran ?

Object

428Object22/06/2002 12:49:48

Hola busta, soy ecuatoriana y quiero decirte que me encantas! al igual que a muchas aqui. Mi pregunta es ¿Que se siente saber que en varios paises del mundo estan gritando tu nombre y te adoran ? jessy

Object

429Object22/06/2002 12:50:25

busta querido tu disco esta de 10. no pensais venir de gira por latino america? te mando un beso desde republica dominicana . (Teany Massiel Grullon)

Object

430Object22/06/2002 12:50:40

hola david.solo decirte qte quiero muxo y siempre tendras mi apoyo.cunado tu esta feliz yo tb lo estoy y cuando sufre yo tb.y ahora q estas mu feliz por tu exito yo tb lo estoy.muxa suerte te quiere JANET(de vitoria 14 años)

Object

431Object22/06/2002 12:51:08

Hola,soy Laura de Barcelona,y una fan incondicional tuya,mi pregunta es la siguiente:Cual seria el primer consejo que les darias a los concursantes de Operacion Triunfo 2?? Por cierto,fui una de las que estuvo contigo en Cronicas Marcianas,de tu club de fans,nunca olvidare aquel dia,cuidate mucho,Te queremos !!!!!

Object

432Object22/06/2002 12:55:27

me gustaria saber como puedo contactar con david bustamante ya que quisiera que me mandara una foto dedicada para mi hijo que el dia tres de julio cumple 3 añitos,y es el fan numero uno de busty(asi le llama el)

Object

433Object22/06/2002 12:55:43

¿ Que tipo de canciones interpretarás en el futuro?

Object

434Object22/06/2002 12:57:09

La fama ¿es como pensabas?

Object

435Object22/06/2002 12:57:43

Hola David!!!Q tal?Solo queria preguntarte que es lo que sientes cuando ves a toda esa gente cantando tus canciones?Gracias por ser como eres, no cambies nunca.Un besazo guapo.Lucía.(León)

Object

436Object22/06/2002 12:58:44

Tras toda esta experiencia ¿has cambiado algo de tu forma de ser porque te has dado cuenta de que actuabas mal en algo?

Object

437Object22/06/2002 01:00:51

Primero que todo quisiera saludar a david y felicitarlo por su gran exito.QUISIERA PREGUNTARLE CUANDO VA A REALIZAR UNA GIRA POR SURAMERICA, ESPECIALMENTE CUANDO VENDRA A VENEZUELA Y CUANDO SALE SU CD.LE MANDO UN BESO ESPECIAL DESDE VENEZUELA. Lo saluda su fan con mucho amor . Roxana Fernandez .VALENCIA-VENEZUELA

Object

438Object22/06/2002 01:02:11

¿as perdido muchos tonos desde que salistes de operacion triunfo?

Object

439Object22/06/2002 01:02:24

cómo sabremos quien es el verdadero bustamante????? es solo para los socios????

Object

440Object22/06/2002 01:06:03

HOLA BUSTA!!ME ENCANTA TU DISCO Y ME GUSTARIA QUE ME LO PUDIERAS FIRAMAR, VAS A HACAER FIRMA DE DISCOS? DONDE? CUANDO? MUCHAS GRACIAS Y MUCHOS BESOTES GUAPO!!SHEILA#

Object

441Object22/06/2002 01:07:45

¿con cual de tus compañeros arias un duo si no triunfaras en solitario?anabel melilla

Object

442Object22/06/2002 01:08:18

¿que es lo que mas te gusta de la musica?anabel melilla

Object

443Object22/06/2002 01:10:43

q tal wapeton? soy una chica de pamplona q esta locamente enamorada de ti,mi sueño era ir a tu concierto pero sq me voy todo el mes de julio fuera.asi que me gustaria saber a que sitios vas de gira en agosto.este es mi movil 619187394 ya se q no lo vas a utilizar muxo pero x intentarlo... q sepas q TE QUIERO UN MONTÓN, eres el mejor sigue así campeón 1BESOTE MU GORDO CON MUXO CARIÑO TU FAN Y AMANTE Nº1 ELVIRA

Object

444Object22/06/2002 01:11:36

¿que es lo que mas te gusta de cada uno de tus compañeros?anabel de melilla

Object

445Object22/06/2002 01:12:28

¿¿que es lo mas peligroso que harias por cumplir tu sueño?anabel de melilla

Object

446Object22/06/2002 01:13:22

David soy una gran admiradora tuya, ya se que todo lo que esta pasando te encanta y que llevas bastante bien el agobio de la gente que te queremos pero seriamente no ha habido ningun momento en el que has hechado de menos tu anonimato y has deseado aunque sea por un segundo ser el chicho que eras antes.

Object

447Object22/06/2002 01:13:32

¿que piensas sobre el fanatismo de tus fans?anabel de melilla.

Object

448Object22/06/2002 01:14:26

¿has pensado en dedicarte, más adelante, a la interpretación?

Object

449Object22/06/2002 01:14:48

¿ que es lo mas raro que has hecho para ver a tu artista favorito? anabel de melilla.porcierto:¿sabes donde esta MELILLA?

Object

450Object22/06/2002 01:18:53

Si, no te hubieras dedicado a luchar por tu sueño;¿por qué otra actividad te inclinarías?aprovecho para saludarte desde acá de Colombia, te admira Silvana

Object

451Object22/06/2002 01:19:12

Busti soy Samantha de Peru, me gustaria muchisimo que te comuniques con migi........T.Q.M

Object

452Object22/06/2002 01:19:53

Soy Samantha de Peru mi mail es tsf_rocks@hotmail.com

Object

453Object22/06/2002 01:21:17

¿Como te sientes al haber vendido 1.250.000 copias de tu disco, consiguiendo el disco de diamante?

Object

454Object22/06/2002 01:22:37

Se que gracias a OT has conseguido alcanzar tu sueño, tocarlo con los dedos , pero ¿no es ahora un lastre en tu carrera artistica?.A mi me encantaria oir hablar del David cantante y no del ex-concursante. Enhorabuena por el magnifico disco, tu voz es increible. Gracias David, te queremos. Marian-Lugo

Object

455Object22/06/2002 01:24:32

¿alguna vez soñastes en llegar a tener toda la fama que tienes?

Object

456Object22/06/2002 01:27:23

hola busta soy una niña de 12 años y me gustas mucho.¿Porque negais Gisela y tu que teneis rollito? encima del escenario siempre al acabar la cancion casi os dais un pico.o no?te kiero mucho ojala tuviera la oportunidad de conocerte.ire a tu concierto a verte cueste lo que cueste.eres el mejor guapo

Object

457Object22/06/2002 01:28:59

En un video estabas estupendo en la canción italiana "Santa Lucia", y a capella tu voz es tan fresca y rica en matices.... ¿No te gustaría incorporar a tu repertorio algo más a parte de pop melódico? Un abrazo de un admirador. Fernando Cristóbal, Vitoria

Object

458Object22/06/2002 01:29:19

hola busta soy la chica de 12 años.¿Por que ahora te estan cambiando de look, por ejemplo en eurovision?¿no te gusta mas como siempre? a mi si . aunqu para mi estas guapo siempre.te quiero mucho besos

Object

459Object22/06/2002 01:31:03

hola busta soy la de 12 años.¿Por que vas a hacer la gira con Vero y no con Gisela? Me parece ingusto tus canciones con Gisela son las mejores.(Aunque las de tu disco sean las mejores de todas)Te quiero mucho.besos guapo.

Object

460Object22/06/2002 01:31:50

hola busta soy la de 12.(me llamo Tamara)¿Con quien te gustaria hacer la gira tuya de chicas? te kero besos

Object

461Object22/06/2002 01:32:36

¿Tienes pensado venir a México? y si es así ¿donde te presentarias?

Object

462Object22/06/2002 01:34:04

Eres consciente de la cantidad de gente que esta loka por ti? De lo que seria capaz la gente por verte? Bixita

Object

463Object22/06/2002 01:37:50

Hola David, me gustaría saber si en tu gira podrías pasar por León,ya que vienes a Ponferrada pero no puedo ir a verte y estoy muy triste.Te quiero muchísimo y espero que dures muchos años en el mundo de la música, ya que eres el único cantante que me ha hecho llorar y eso es por algo.No hagas caso de los comentarios y sigue asi.¡Eres el mejor!.

Object

464Object22/06/2002 01:38:58

HOLA DAVID: SOY UNA GRAN ADMIRADORA TUYA ME DA MUCHA LASTIMA ESTAR TAN LEJOS DE TI PORQUE VIVO EN EL SALVADOR UN PAIS QUE ESTA SUPER LEJOS DE DONDE TU VIVES FIJATE QUE ME DA MUCHO GUSTO EL HABER ESTADO EN EL CONCIERTO QUE DIERON EN BARCELONA. NO ME IMPORTO HABER VIAJADO A UN LUGAR TAN LEJOS PARA IRTE A VER. SOS EL MAS GUAPO DE TODOS, Y EL MAS DULCE ESPERO QUE AHORA QUE TERMINARON EN LA ACADEMIA SIGAS SIENDO EL MAS LINDO Y DULCE DE TODOS. TE QUIERO MUCHO Y TE DESEO EL MAYOR DE LOS EXITOS, CON CARIÑO TU MAS FIEL ADMIRADORA DE EL SALVADOR:GERALDINA

Object

465Object22/06/2002 01:39:23

hola busta, te quiero felicitar por tan grandioso talento q tienes, y q eres mi ejemplo a seguir ya q me facinan las baladas, y me presentare al ot de Colombia, q consejo me das pa` pasar las pruebas? (Henry / Colombia), pd: me gustaria gravar una balada a duo contigu, q dices??

Object

466Object22/06/2002 01:40:13

Hola!!!Bello y Talentoso busta,pues soy de Puerto Rico y vivo en la Rep.Dominicana y mi pregunta es:¿CUALES CREES DE LAS TANTAS Y LINDAS CUALIDADES QUE TIENES, SON LAS QUE MAS NOS GUSTAN A TUS FANS Y LAS QUE HAN SIDO EL PUENTE PARA LLEGAR A CUMPLIR ESTE LINDO SUEÑO?? Besos para ti, que Dios te vendiga y sigas teniendo muchisimo exito te deceo de corazon una fiel fan!!!

Object

467Object22/06/2002 01:40:21

Hola!!!! Soy Claudia Escobar del Distrito Federal, sinceramente me gustó mucho el programa de operación triunfo, lamentablemente lo vi en las últimas galas, pero aun así apoyo a todos los participantes. Lo imporante de esto es que tiene un talento increible, son sencillo que eso es lo que vale, bueno me dejo de tanto choro y me gustaría que me contestáras cuándo van a venir a la ciudad de méxico y si van a visitar a los nuevos integrantes que van a formar parte de operación triunfo aquí en méxico??, perdón por tanto choro pero la verdad estas guapísimo y eres super lindo. chao

Object

468Object22/06/2002 01:41:00

Hola!!!Bello y Talentoso busta,pues soy de Puerto Rico y vivo en la Rep.Dominicana y mi pregunta es:¿CUALES CREES DE LAS TANTAS Y LINDAS CUALIDADES QUE TIENES, SON LAS QUE MAS NOS GUSTAN A TUS FANS Y LAS QUE HAN SIDO EL PUENTE PARA LLEGAR A CUMPLIR ESTE LINDO SUEÑO?? Besos para ti, que Dios te vendiga y sigas teniendo muchisimo exito te deceo de corazon una fiel fan!!!ATT:Ivanova Rodriguez

Object

469Object22/06/2002 01:44:16

Hola!!Bello y talentoso Busta Soy de Puerto Rico y vivo en la Rep.Dominicana mi preguntita es:¿en que te basaste para elegir las canciones para tu cd y sean tan buenas y para lograr ser el mejor cd que he escuchado en mi vida?Esta exelente. ATT:Ivanova Rodriguez Tu Fiel fan.

Object

470Object22/06/2002 01:44:22

Tras el éxito obtenido con tu primer disco"BUSTAMANTE", tienes proyectos de nuevas canciones para tu segundo trabajo discográfico.TE QUEREMOS,dos fans.

Object

471Object22/06/2002 01:47:26

Hola!!Mi Chico Talentoso, soy de Puerto Rico y vivo en la Rep.Dominicana mi preguntita es:¿CUANDO TE VIENES DE GIRA POR EL CARIBE A LA REP.DOMINICANA AQUI YO Y MUCHOS MAS TE ESPERAMOS CON ANSIAS? ATT:Ivanova Rodriguez (Besos para ti Dulces y Traviesos)

Object

472Object22/06/2002 01:48:39

hola guapetón! me llamo Noelia. eres genial, me gustaría que me hicieses un favor, puedess llamar a una amiga y dedicarle una canción, o simplememnte hablar con ella? un besazo guapetón, mucha suerte. posdata: se llama Laura. hola David me lla mo Noelia. me gustaria poder ir un día de fiesta contigo. te atreves. Te envio mi num. del movil para que me llames para quedar. cuando puedas. 659113418 piensas hacer otro disco? Noelia

Object

473Object22/06/2002 01:50:43

¿Vendrá David Bustamante a Venezuela en gira promocional? Aquí lo estamos esperando con el corazón abierto. Un beso y que Dios lo bendiga.

Object

474Object22/06/2002 01:52:37

No nos vais a aclarar nunca que hay hubo o habrá entre Gisela y tú... a los fans tanto de uno como de otro nos gustaría saberlo... ENHORABUENA POR EL DISCO ESTÁ GENIAL!!!!!!!!!!!!!!!!!!

Object

475Object22/06/2002 01:54:08

Eres consciente de la capacidad que tienes para llegar a la gente, tanto a jovenes como a mayores, y poder aprovecharla e intentar mejorar un poco este mundo. SONRIE Y SE FELIZ

Object

476Object22/06/2002 01:54:35

¿Que hay del duo con Sergio Dalma? en tu disco no está... espero que no se haya rechazado la opción porque sería genial... ¿Por que no haces también otro con Cristian? Sería la bomba... ¡¡¡Enhorabuena por todo campeón...!!!

Object

477Object22/06/2002 02:00:08

¿Como es la chica de tus sueños? ¿crees en el destino? ¿crees que tu destino era trabajar en la musica? ¿ayudarias a gente que quiere empezar en la musica? ¿como?

Object

478Object22/06/2002 02:00:36

hola david!soy lorena de valencia.¿ke echas de menos de tu antigua vida?un besazo enorme.espero ke te vaya todo igual o mejor.;)

Object

479Object22/06/2002 02:01:17

Hola David, me llamo Sahara y vivo en Panamá (centroamérica), quiero que sepas que aqui soy presidenta de un fans club tuyo junto con Bisbal y que nos encantaria saber si ¿algun dia vendrias por acá?. Si me pudiese mandar algun mensaje en mi e-mail es sahara_7@hotmail.com Besos.....

Object

480Object22/06/2002 02:04:04

Hola!!Mi lindo Talentoso,Soy de Puerto Rico y vivo en la Rep.Dominicana mi preguntita es:¿Alguna vez has sentido un amor tan grande y lindo por una persona y ese bello amor no se a podido desarrollar por causas fuera de ti, lo estoy pasando en estos momentos y me gustaria saber si mi artista favorito osea tu le a ocurrido alguna vez? ATT:Te quiere mucho y te manda **Besos Dulces y traviesos tu Fan Ivanova Rodriguez.

Object

481Object22/06/2002 02:04:55

intentas conectar y responder a todas tus fans? tienes un club de fans en barcelona?

Object

482Object22/06/2002 02:06:12

HOLA DVIS SOY UNA CHICA DE PARLA MADRID DE 26 AÑOS NO SOY UNA FANS HISTERICA ESTOY DESEANDO ENCONTRAR TU DIRECCION PARA MANDARTE UNA CARTA Y NADA SOLO QUERRIA HABLR CONTIGO DE VERDAD ES IMPORTAN TE LLAMAME O ESCRIBEME POR FABOR AZ UNA ESCEPCION POR DIOS chiquilla25@hotmail.com o LLAMAE 625458736 ALICIA POR FABOR AYUDAME OK UN BESAZO ERES EL MEJOR Y RECUERDA QUE NO SOY UNA FANS HISTERICA QUE TENGO 26 AÑOS YS E LO QUE DIGO POR FBAOR UN BESAZO DAVID ESPERO CON ESPERANZAS ALGO D ETI UN BESO

Object

483Object22/06/2002 02:07:22

DAVID ME LLAMO ALICIA SOYD EMADRID TENGO 26 AÑOS Y N SOY UNAFANS HISTERICA LLAMAME ES URGENTE POR FABOR NOE S NINGUNA TONTERIA POR FABOR 625458736 POR FBAOR ESPERO TU LLAMDA HAZLO POR MI POR DIOS?

Object

484Object22/06/2002 02:08:08

HOLA DAVID, SOY DE REPUBLICA DOMINICANA Y QUIERO SABER CUANDO VENDRAS A MI PAIS A RELIZAR ALGUN CONCIERTO O A PROMOCIONAR TU CD? SHERLIE PEREZ

Object

485Object22/06/2002 02:08:29

hola mi nombre es krizia y he seguido este programa desde que empezo pero particularmente a ti! soy de venezuela pero proximamente me mudo a españa crees que habria alguna posibilidad de hacer un duo contigo????? te amooooo

Object

486Object22/06/2002 02:10:17

BUSTAMANTE, ¡colega!, soy un chaval de PUCELA de 16 años, y te azmiro como un BUEN CANTANTE...ójala me gustaría verte alguna vez en persona... enga un salu2...y que me encanta tu música, ¡TIO! P.D.: en mi cole me dicen que canto igual o parecido que tú.

Object

487Object22/06/2002 02:10:48

soy sol, y queria decirte que te quiero mucho. soy de corrientes capital, argentina. ¿cuando habra otro especial? gume@arnet.com.ar

Object

488Object22/06/2002 02:12:37

¿porque no son novios con gisela? hacen muy linda pareja. gume@arnet.com.ar

Object

489Object22/06/2002 02:14:26

Hola Busta! Soy una fan de Ferrol (La Coruña) y quisiera desearte mucha suerte y hacerte un par de preguntas: 1)¿ Al final vas a pasar por Ferrol en tu gira? 2)¿ Cúantos discos has vendido hasta ahora? Muchas gracias. (Se dice que ya eres disco de diamante) Te deseo muchisima suerte en tu carrera musical, eres un gran artista. También en Galicia hay mucha gente que te quiere y apoya.

Object

490Object22/06/2002 02:14:26

Hola.. somos las actrices venezolanas que conociste en el hotel en Santander... queriamos saber si ademas de Mexico vienes a otro pais de Latinoamerica... te queremos y recordamos muchisimo a ti y a la atención de familia... Dios te bendiga.. Carmencita Padrón y Natasha Moll..

Object

491Object22/06/2002 02:18:18

hola david, me gustaria saber si vas a venir a promocionar a mexico si es si mas o menos para cuando te tendremos en nuestro pais, te admiro mucho, ojala vengas pronto. veronica sosa

Object

492Object22/06/2002 02:18:24

HOLA ROSA SOY MARIA FERNANDE CASTRO DE ECUADOR ,AMBATO,Y LAPREGUNTA ES ,COMO PUDISTE HACER TUS SUEÑOS REALIDAD Y LLEGAR TAN ALTO COMO LO ESTAS AHORA ,TE QUIERO MUCHO Y TE ADMIRO TANTO ,Y ME ENCANTARIA LLEGAR HASTA DONDE ESTAS TU ,TALVEZ NOS VEAMOS PRONTO EN ALGUN ESENARIO COMPARTIENDO ALGUNA CANCION ,SE DESPIDE DE TI MARIA FERNADA CASTRO ,CHAOOOOOOOOOOOOOOOOOOOOOOO

Object

493Object22/06/2002 02:19:45

hola busta, es clarisa de venezuela es lo mejor te mando un beso y muchos saludos mi pregunta es ¿habra la psoibilidad de que alguna vez vengas para venezuela aqui son muy famosos? un beso grande suerte eres el mejor te ammmmmmooooooooo clarisa de venezuela

Object

494Object22/06/2002 02:20:55

BUSTA ERES GRANDIOSO. SOMOS UN GRUPO DE CHICAS DEL ECUADOR Y NOS HAS CONQUISTADO. SIMPLEMENTE ERES UN TRIUNFADOR, LO QUE QUEREMOS SABER ES QUE SI HAS PLANEADO GIRAS POR SUDAMERICA Y COMO NO A ECUADOR. SU PROGRAMA A TRASPASADO FRONTERAS Y NOS ENCANTARIA VERLOS EN VIVO. CADA PERSONA AL DESPERTAR SOÑO EN ALGO Y ESPERA ANSIOSO PARA QUE ESE GRAN SUEÑO SE HAGA REALIDAD, USTEDES YA LO LOGRARON, CON LAGRIMAS, CON ESFUERZO, CON EMOCIONES. EL CONSEGUIR UNA META ES PROPONERSE DIA A DIA A SER MEJORES Y USTEDES DEFINITIVAMENTE LO LOGRARON. SON MARAVILLOSOS Y CADA UNO CON UNA HISTORIA DIFERENTE NOS HA CAUTIVADO. NUNCA CAMBIEN SIGAN CONFIANDO EN USTEDES PORQUE DIOS YA OS PREMIO Y LO SEGUIRA HACIENDO. ESPERAMOS VERLOS MUY PERO MUY PRONTO CAMPEONES. BESOS, ABRAZOS DE TODO CORAZON DESDE ECUADOR JHOJHANNA, STEPHANNIE Y DIANA. SUS FANS NUMERO UNO.

Object

495Object22/06/2002 02:21:30

hola, soy de Mexico y me gusta tu musica, mi pregunta es ¿que es lo que hace diferente a la musica de David Bustamante del resto de baladas como cristian castro o luis fonsi, es decir, que nos ofreces? Karina G.

Object

496Object22/06/2002 02:21:46

hola DAVID BUENO MI PREGUNTA ES; TE GUSTAN LAS CHICAS ECUATORIANAS? Y COMO HACES PARA SER TAN GUAPO? TE QUEREMOS MUCHO CAROLA Y ALEJA.

Object

497Object22/06/2002 02:21:56

hola es clarisa de venezuela, eres grande, guapo y bello ¿ que te parece la fama que ha tenido ot en otros paises como puerto rico venezuela, mexico etc. y si existe la pocibilidad de que vengas, aqui hay un club de fans que estamos deseosa de verlos? bueno me despido deseandote lo mejor y mucha suerte besos clarisa de venezuela

Object

498Object22/06/2002 02:22:39

soy una super fan venezolana y quisiera saber si vas a realizar una gira por latinoamerica y si vas a visitar a Venezuela. Maria Gabriela Matamoros Nick_girl_gaby@hotmail.com

Object

499Object22/06/2002 02:22:51

Cual crees que es tu meta a partir de ahora??? hasta ahora lo estás haciendo muy bien guapo. Bicos. De una fan tuya de Vigo.

Object

500Object22/06/2002 02:25:35

HOLA DAVID COMO ESTAS ,Y LA PREGUNTA ES LA SIGUIENTE ,COMO LOGRASTE TODOS TUS SUEÑOS Y COMO LOGRASTE LLEGAR HASTA DONDE LO HAS HECHO ?,SOY UNA GRAN ADMIRADORA DE UN PAIS LLAMADO ECUADOR ,AMBATO,Y DESDE AQUI TE MANDO UN BESITO ,Y TALVEZ NOS VEAMOS EN ALGUN ESENARIO COMPARTIENDO ALGUNA CANCION JUNTOS ,TE PARECE ! CHAO TE QUIERE Y ADMIRA MARIA FERNANDA CASTRO

Object

501Object22/06/2002 02:26:57

Eres muy joven y tu carrera va en ascenso. Tu música está sonando en muchas partes, especialmente en Puerto Rico. ¿Hasta dónde piensa llegar Bustamante? Marla Irizarry, Puerto Rico

Object

502Object22/06/2002 02:28:01

me encantas soy fan tuya, me fascina tu voz,tu forma de ser, tu cuerpo, tu linda cara, eres genial,quisiera alguna vez chatear contigo, nose tener una conversación contigo, porfa Puedes escribirme a mi e-mail? me encantaría que lo hicieras te lo pido porfa te quiero mucho mi e-mail es: priss_ee@hotmail.com. bye no olvides a tu fiel admiradora Priss

Object

503Object22/06/2002 02:30:05

¿Que canción te tu disco a significado más para ti?¿Porqué?Te deseo todo lo mejor del mundo en esta nueva travesía que has emprendido en tu vida. San Juan, Puerto Rico

Object

504Object22/06/2002 02:32:46

david soy thais la chica rubia con la que estubiste el viernes en el hotel, que te dije que eras lo mas guapo que hay en este mundo y tu contestaste no sois vosotras, no puedo estar para el chat en directo porque tengo un examen,te pregunto ¿que sientes al ver a tantos fans que quieren estar un momento contigo, tu querer tambien y que no te dejen? besos, thais ( madrid ) eres el mejor no cambies nunca.

Object

505Object22/06/2002 02:36:08

Hola soy de Costa Rica quisiera saber si entre tus planes esta el hacer consiertos en otros paises, como los de America, si tu respuesta es si ,te estaremos esperando felicidades

Object

506Object22/06/2002 02:55:59

Hola David me gustaría preguntarte si en un próximo disco realizarás el duo con Sergio Dalma o si colaboraras tu en el suyo? espero que si porque Sergio y tu me encantais.Un beso.Meritxell

Object

507Object22/06/2002 02:57:44

Davis hola soy de Colombia, te quiero felicitar a ti y de paso que le lleves mis saludos al resto del grupo si puedes, me alegra mucho de que personas como tù salgan adelante y lo màs importante que nunca se te olvides de donde eres, mi pregunta es que si piensas algùn dìa venir a Colombia?, para que lo sepan ustedes, aqui tienen tambien fans y la verdad me encantarìa tener la oportunidad de si no conocerlos como mìnimo verlos en concierto en vivo y a todo color, mi hermano menor tiene una amiga que dice ser prima tuya se llama Alba hernandez y te hemos miles de mensajes con ella y la verdad no sabemos la verdad si es tu prima o nó, èl se comunica con ella por el msn de hotmail, David te deseo todo lo mejor son todos admirados por toda mi familia y por mi, miles de èxitos y aqui los esperamos.

Object

508Object22/06/2002 03:00:56

Soy de Uruguay y fans perdida, solo quiero saber si realmente sos feliz ya que hay tanta gente que lo es por tii que para mi basta con eso.- Muchos besos.- Laura

Object

509Object22/06/2002 03:07:14

david, cuando eras chico ¿que era lo mas te gustaba hacer en tu tiempo libre?

Object

510Object22/06/2002 03:08:07

Hola David desde uruguay solo decirte que te felicito, y preguntate si tienen pensado hacer tanto tu como tus compañeros giras, a paises,de latino america, chiquitos como el mio pero en el que tienen grandes admiradoras.como yo.

Object

511Object22/06/2002 03:10:39

David estas buenisimo haz pensado venir a Ecuador a ofrecer un concierto? besos Lorena Cisneros Quito-Ecuador

Object

512Object22/06/2002 03:10:57

Hola soy Sandra, te escribo desde méxico, y me gustaría saber cuando visitaras a todas las fans de mi país?? te estamos esperando!!! muchas felicidades y mucho éxito

Object

513Object22/06/2002 03:14:37

Hola wapo!Que tal te va todo?Yo te ire a ver cuando vayas a Vigo espero poder estar cerca y pedirte un autografo..Cantais alguna cancion Vero y tu juntos,en el concierto? Muchos besos

Object

514Object22/06/2002 03:15:08

Hola david busta soy veronica nalerio de uruguay y me gustaria saber cuando vas a venir a uruguay y por favor contestame el mail que te e mandado hace unos dias te amo mucho y siempre te voy a querer ya amar mucho .Firma:Veronica nalerio

Object

515Object22/06/2002 03:15:18

hola guapetón,crees q tienes mucho q aprender o ya solo te queda pequeños temas.mireia (cubelles)

Object

516Object22/06/2002 03:19:00

hola guapetón!¿las parejas de las giras las escogisteia vosotros o os lo mandaron?De una catalana que te qiuere con locura.

Object

517Object22/06/2002 03:20:22

¿Crees q salir de los 3 gandores te ha veneficiado más q el resto?ánimo campeón

Object

518Object22/06/2002 03:21:50

Hola, soy Sandra de México, y me gustaría saber cuando vendrás a visitar a todas tus fans mexicanas, te estamos esperando!!! Muchas felicidades por el éxito alcanzado Besos

Object

519Object22/06/2002 03:30:23

HOLA DAVID TE QUIERO DECIR QUE ME GUSTAS MUCHO, ME ENCANTA COMO CANTAS LE PONES UN SENTIMIENTO TAN CHEVERE QUE ME REENCANTAS. MI PREGUNTA ES CUANDO VAS A VENIR DE GIRA POR ECUADOR ( CUENCA). BESOS TE QUIERO MUCHISIMO SIN DUDA ERES EL MEJOR DE OPERACION TRIUNFO. SUERTE

Object

520Object22/06/2002 03:35:25

Que se siente ser tan acosado por las mujeres

Object

521Object22/06/2002 03:36:12

Desde Puerto Rico Escuchamos tus canciones y admiramos tu talento. Crees que algun dia podras visitarnos y deleitarnos con tu presencia en nuestra isla? Bendiciones y mucho exito para ti y los tuyos. TQM Cidra

Object

522Object22/06/2002 03:37:10

Q si cree posible q la fama no va a subirsele a la cabeza y si va ha ser capaz de mantener los pies en la tierra

Object

523Object22/06/2002 03:48:16

soy una persona adulta pero me llama la atención tu forma de ser. no estoy segura pero si más no recuerdo expresastes en alguno de los programas que tu eres una persona humilde?

Object

524Object22/06/2002 03:49:13

crees que cambiaras tu forma de ser?

Object

525Object22/06/2002 04:08:39

busta me llamo isabel soy de venezuela y soy tu fan numero 1 aqui en mi pais te mando muchos, tengo tu cd todas tus fotaos se te quiere mucho guapo, besos¿cuando vas a venir a venezuela a promocionar tu disco?

Object

526Object22/06/2002 04:10:15

hola soy de venezuela y me gustaria saber cuando vas a promocionar tu disco aqui ?'

Object

527Object22/06/2002 04:13:12

hola soy de venezuela y me gustaria cuando vas a venir ?''

Object

528Object22/06/2002 04:21:50

DAVID TIENES PLANES DE VENIR A PRESENTAR TU DISCO EN AMERICA LATINA?, AQUI TIENES MUCHISIMAS ADMIRADORAS YA QUE OPERACION TRIUNFO ES TODO UN EXITO. TU ADMIRADORA VENEZOLANA ANDREINA

Object

529Object22/06/2002 04:27:52

Hola Busta!!! Me llamo Rossy y soy de México...soy super fan de OT y aunque el cambio de horario es muy diferente tratare de estar para el chat contigo. Sólo quiero preguntarte ¿alguna vez piensas visitar México con tu música? Sería increible y seguramente te íria super bien...¿Que cantantes mexicanos te parecen buenos? Gracias. Un beso Rossy

Object

530Object22/06/2002 04:29:03

hola que tal.., bueno, mi pregunta es:es bustamante enla vida real lo que refleja? bueno creo que si me pareces buana persona y me caes muy bien, espero que pases por latinoamerica que te estamos esperando con los brazos abiertos. un fuerte apreton de mano. victor

Object

531Object22/06/2002 04:30:55

Busta: Soy uruguaya de la capital (Montevideo) y queria saber si estabas informado de que a pesar de la graaaan distancia , aqui los vemos siempre por la TVE internacional y queria saber si piensas pasear por estas tierras? Saludos a ti y a tus compañeros que son todos unos genios!!! MaJiTo

Object

532Object22/06/2002 04:33:23

hola mi pregunta es : ¿ya que hace rato que no tienes sexo? ¿que haces? te masturbas???? bue bueno un beso davinia

Object

533Object22/06/2002 04:42:22

Cuando piensa Vale Music traerlos de gira a Puerto Rico ya que al presente se transmite por TVE (triunfomanía) todos los martes, y queremos verlo en persona. Gracias. Busta te queremos sigue así.

Object

534Object22/06/2002 04:46:14

Hola David, mi pregunta es la siguiente; dentro de unos meses ya inicia la segunda edición de Operación Triunfo crees que el éxito tuyo y de tus compañeros puede verse afectado con la salida de los nuevos integrantes de la Academia? Evelyn, República Dominicana.

Object

535Object22/06/2002 04:49:11

En mi país aún no ha llegado tu disco, ¿cómo lo describirías a los que aún no han escuchado todos los temas del mismo? (Liza, Panamá)

Object

536Object22/06/2002 04:55:25

HOLA DAVID,SOY UNA FAN TUYA QUE SE VINO A VIVIR A NEW YORK,NO SABES QUE MAL LO PASO SIN OIR TUS CANCIONES EN LA RADIO!!PERO ME TRAJE EL CD Y LO PONGO EN EL COCHE A TODO VOLUMEN Y LOS AMERICANOS ME MIRAN CON UNA CARA... ME DA IGUAL ERES EL MEJOR Y TE ECHO DE MENOS.MIL BESOS DE KATHY ALAYO.

Object

537Object22/06/2002 04:55:30

¿La fama no ha hecho que seas otro?¿Vendras de gira por el Caribe?.Un abrazo.Artista

Object

538Object22/06/2002 04:55:46

¿La fama no ha hecho que seas otro?¿Vendras de gira por el Caribe?.Un abrazo.Artista.Eva

Object

539Object22/06/2002 04:57:14

¿Que le dirias a los chicos que van entrar ahora a la Academia?Besos.Desde el Caribe.Eva

Object

540Object22/06/2002 04:59:02

Saludos desde Puerto Rico. Tienes programado hacer alguna presentacion en PR? Te esperamos. Muchos exitos.

Object

541Object22/06/2002 05:03:00

TIENES NOVIA?

Object

542Object22/06/2002 05:29:07

David, somos de chile. Tenemos una hermana en España ( San Sebastian ), te hemos conocido por medio de ella que te adora, tenemos grabado todos tus programas ( noches de gala ) y un CD. Nustra hermana de San Sebastian necesita que que alguna fans se comunique con ella, para poder asistir algun recital que se de cerca de San Sebastian. David o Busta el sueño de ella es que la llames al fono ( 943-211023 ). Busta somos del fin del mundo "Chile" y ya te adoramos, por intermedio de Regina, nuestra hemana de San Sebastian.

Object

543Object22/06/2002 05:32:13

soy venezolana, y te admiro mucho por tu talento y tu gran corazon. Quisiera saber si en tu gira internacional incluiras a Venezuela que somos muchos los que te esperamos aqui.

Object

544Object22/06/2002 05:42:34

te atraen los hombres o sea eres gay?

Object

545Object22/06/2002 05:42:56

HOLA BUSTA Mi nombre es Rosita Jaramillo,te mando un saludo cariñoso desde este lejano país Ecuador,primero quiero decirte que eres el artista de mi corazón en donde supiste llegar muy profundo. Bueno mi pregunta es si tienes planeado empezar a promocionar tu CD por aca en Ecuador, y si asi lo haces sería posible que nos visites por aca (lo esperaré con mucha ansias) BESOS

Object

546Object22/06/2002 05:50:23

No es una pegunta es mas bien una felicitación para Bustamante, por ser una persona tan humilde y sincera, cosas que espero; nunca lo cambie , ya que es de lo principal que todos los artistas deberían de tener. Y si sigues así; llegaras muy lejos - Trata de no cambiar, a causa de la popularidad, para tu propio bien- Felicidades Sigue así...

Object

547Object22/06/2002 05:50:33

No es una pregunta es mas bien una felicitación para Bustamante, por ser una persona tan humilde y sincera, cosas que espero; nunca lo cambie , ya que es de lo principal que todos los artistas deberían de tener. Y si sigues así; llegaras muy lejos - Trata de no cambiar, a causa de la popularidad, para tu propio bien- Felicidades Sigue así...

Object

548Object22/06/2002 05:58:57

Hola, David Bustamante espero que estes muy bien. Mi pregunta es saber cuando vienes para Puerto Rico ya que por estos lados tu cancion suna mucho y tienes muchos seguidores. Bueno espero que te vaya bien en tu carrera y sigue hacia delante cuidate mucho bye ATT: Luis Antonio rivera_luis19@hotmail.com

Object

549Object22/06/2002 06:04:35

Hola,me llamo viviana y soy de Uruguay y queria preguntar si David hara una gira por latinoamérica incluyendo mi pais; porque aca es muy querido y nos gustaria que viniera.

Object

550Object22/06/2002 06:07:51

HOLA BUSTAMANTE, SABES SOY DE MEXICO Y ME GUSTARIA SABER SI TIENEN PENSADO VENIR A MEXICO, CON GUSTO TE ESPERO EN MEXICO, MI NOMBRE ES BETO ESPERO ME ESCRIBAS A MI CORREO pitugualasem@hotmail.com

Object

551Object22/06/2002 06:15:54

¿Qué ensenanzas y consejos puedes brinda a chicas y chicos que te siguen no solo en Espana sino en otros países como en Ecuador para alcanzar el éxito con tanta sencillez? Johanna, Quito - Ecuador

Object

552Object22/06/2002 06:18:55

DAVID, HARAS VISITAS A LOS PAISES QUE TE ESTAN CONOCIENDO, COMO ECUADOR. TE ESPERO PRONTO. SUERTE Y QUE DIOS TE BENDIGA EN TU CARRERA. ANTONIA PICO COELLO

Object

553Object22/06/2002 06:41:29

Busta necesitamos saber cuando vamos a disfrutar de tu musica, de tu voz y de ti...Te queremos y te apreciamos aquí en Venezuela...Cuándo vas a venir??? Una admiradora que te aprecia y le gustaria tenerte. Ana Cristina...Venezuela.

Object

554Object22/06/2002 06:58:33

Hola bustamante soy Francia Nelly De Republica Dominica yo segui operacion triunfo por cable. yo quiero que los cd de ustede lo tiere mundial pq en Republica Dominica ahy mucha fan un mucha persona que segue operacion truinfo no gustaria que vinia al pais pq no gustaria mucho por lo meno los 16 por que para nosotroseria muy chulo a unque casi no se conoser pero no gustaria que viniera a Rep, dominicana, Ok bye mucho exito y que por favor venga , bye bye cuidate!!

Object

555Object22/06/2002 07:41:14

¿cuando se presentan en México?

Object

556Object22/06/2002 07:41:56

la verdad que mas que una pregunta quisiera felicitar a David Bustamente y a todos los chicos de operación triunfo ya que son una motivación para todos los jovenes para que luchen por lo que se quiere y que ademas no es facil conseguirlo. Yo soy de Panama y aca tambien se esta viendo el programa pero yo ya lo vi por medio de televisora española y yo lo considero lo maximo. Muchas felicidades y David tu eres una gran cantante y artista aca tienes muchas admiradoras. Chaooo Sabdi (sab30di@hotmail.com)

Object

557Object22/06/2002 08:32:02

lo primero decirte q tienes un disco fantastico y en mi finca se lo saben de todas las veces q lo he puesto. y segundo me gustaría preguntarte cuando vas a venir a valencia a firmar discos xq cuando vengas voy a ir a dormir (si me deja mi madre) al sitio donde vayas a firmar. muchos besos una fan tuya: esther810

Object

558Object22/06/2002 08:40:53

hola soy ale de huelva me gustaria saber q sentirias si dentro de un año, cuando empiece la 2º edicion, la gente no comprara tus discos y tu vida de artista se acabara, ¿volverias a trabajar con tu padre de albañil???????????? muchas gracias y dale un beso a rosa de mi parte

Object

559Object22/06/2002 08:41:14

Eres un chavo muy talentoso, te gustaria visitarnos por aca en Mexico?? y para que fechas?

Object

560Object22/06/2002 09:00:25

David, ¿una mujer guapa y algo "tonta" o inteligente y no tan agraciada? Un besote, cielo. Ana, Madrid

Object

561Object22/06/2002 09:02:11

¿Qué cualidades aprecias más en una mujer?(espero que digas las que a mí me "adornan" Je, je ,je. Cantas de maravilla, guapo, y tu disco es de 10 Victoria (Madrid)

Object

562Object22/06/2002 09:06:13

hola David, me llamo carla y me gustaria saber cuando iras a firmar discos en barcelona o en mataro como izo Alex? adelante sigue asi eres el mejor, no cambies nunca. TE QUIERO MUCHISIMO

Object

563Object22/06/2002 09:11:36

BUSTAMANTE CUANDO VAS A HACER TU FIRMA DE DISCOS EN MADRID.!ERES EL MEJOR!!!GUAPOOOOOOOOOOOOOO

Object

564Object22/06/2002 09:15:00

hola busta soy garazi una bilbaina de 12 años me voy a comprar tu disco, no me lo he comprado todavia porq no me llega el dinero. Te he oido cantar las canciones de tu disco y me encantan creo q tu t merecias ser de los tres primeros ya q cantas muy bien. por cierto ¿hay algo entre gisela y tu? si no quieres no contestes q no te quiero agobiar. besos a rosa mi numero es 652730803 me ilusionaria mucho q me llamarais rosa y tu.

Object

565Object22/06/2002 09:22:21

Estas MUy Guapo y que envidia de la mujer que tengas alado y bueno mi pregunta es cual es tu mayor triufo aparte de este???????

Object

566Object22/06/2002 09:23:14

tienes novia?????

Object

567Object22/06/2002 09:24:03

por que eres tan feo?????????

Object

568Object22/06/2002 09:25:11

por que eres tan feo????????????????????

Object

569Object22/06/2002 09:45:24

bustamante que tal se lleva eso de ser una estrella¿? jo creo q bien pero quiero loa opinion de mi idolo besos guapo

Object

570Object22/06/2002 09:49:17

HOLA BUSTAMANTE ¿FIXECHES ALGÚN EDIFICIO ENTEIRO ALGUHA VEZ????

Object

571Object22/06/2002 09:51:53

¿cuales son tus propósitos para un futuro próximo?

Object

572Object22/06/2002 09:54:15

David bustamante tienes un romance con Gisela

Object

573Object22/06/2002 09:54:40

busta en un futuro no muy lejano intentaras comoponer tus propias canciones? pienso que eso seria la culminación de tu carrera como cantana,tu musica y tu voz esta a un nivel internacional y te podremos escuchar durante toda la vida. rosi de madrid te desea lo que te propongas.nunca pierdas tu riqueza interior porque ante todo somos personas y lo tuyo es un don que dios te a dado no le falles.

Object

574Object22/06/2002 09:57:03

busta ahora que en tu cd tienes canciones movidas te prepararas como bailarin? rosi.

Object

575Object22/06/2002 09:58:41

Como lo estas llevando esto de ser muy muy famoso ????

Object

576Object22/06/2002 10:01:32

ola soy la fan numero 1 de david bisbal y queria preguntarte¿Fue muy dificil la grabacion de tu cd?¿te riñieron muxo?

Object

577Object22/06/2002 10:06:26

Cabe alguna posibilidad, que a pesar de q actualmente su personalidad es de un ser humilde, con el tiempo, la fama, la locura de sus fans llegue de cierto modo a convertirle en un hombre distinto y la humildad presente se transforme en una modestia?

Object

578Object22/06/2002 10:07:59

te a gustado el paso por canarias?¿ bueno yo fui a verte que tengas suerte en tui disco y que sea david bustamante disco de diamante¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

Object

579Object22/06/2002 10:11:17

Bustamante es uno de mis ídolos actuales, me siento muy indentificada con el, pero mis padres no me permiten como a otros chicos/as asistir a conciertos o programas para asi conocerle, me gustaria preguntarle si en algum momento de su juventud estuvo en la misma situación y que siente ahora que es él la persona por kien tanta gente grita y llora por conocerle y verle en los conciertos? Al igual que la cancion de operacion triunfo contiene en su letra: "Sueña...." ¿cres bustamante que ya has despertado de este sueño?Lore. Asturias

Object

580Object22/06/2002 10:12:45

hola david!! Primero de todo felicitarte por tu trabajo por que me a impresionado. Y darte las gracias por ponerte mi pulsera el dia de la rueda de prensa (eurovision)pq ese dia comprendi que eras una persona maravillosa y fue uno d mis mejores dias.Gracias por cumplir un sueño!!!!!! Mariona(Barcelona)

Object

581Object22/06/2002 10:15:57

¿Cuál es bustamente su opinión o ideologia ante aquellas personas, las cuales afirman que su dulcura y sencillez es un mero teatro para asi cautivar a tanto público?¿Podría tratarse en algun momento, en una identificación con usted hace apenas un año, un chico completamente corriente y ahora que usted ha logrado llegar a este máximo sienten quizas envidia o recelo?¿ o quizás es porque no le conocen bien y cren q es un boom temporal?Lore. Asturias

Object

582Object22/06/2002 10:16:05

David, porque crees que los medios estan falseando las ventas de tu disco diciendo que has vendido 500.000 copias cuando ya hace muchisimo tiempo que superaste el millon. Juan Carlos (jc_ontinyent)

Object

583Object22/06/2002 10:25:15

HOLA DAVID! ESQ TENGO UN PROBLEMA ESTE VERANO VOY A IR A SAN VICENTE D LA BARQUERA Y NO SE A Q HOTEL O PENSION IR ME PUEDES RECOMENDAR ALGUNO?¿?¿(A PODER SER AL LADO D TU CASA JEJEJE) MARIONA DE BARCELONA(ERES UN FENOMENO,WUAPETON!!,ERES UNA ESTRELLA Q SIEMPRE VAS A BRILLAR( NO LO DUDES NUNKA)CNT

Object

584Object22/06/2002 10:28:11

Hola guapeton!soy una chica de menorca que te admira y quiere mucho,solo

Object

585Object22/06/2002 10:29:57

HOLA DAVID!!! TE PROPONGO UN RETO SERIAS CAPAZ DE IR A TOMAR UN CAFE CONMIGO (AUNQUE NO ME GUSTE EL CAFE CONTIGO ME SENTARIA MUY BIEN)SERIA UN SUEÑO. TE E CONOCIDO COMO ARTISTA, DESEARIA CONOCERTE COMO PERSONA! UN BESO LIDIA DE BARCELONA(MI TELF LO TIENE TU TIA D SAN VICENTE LA MUJER D JAVIER, LLAMAME!)UN BESOTE ENORME

Object

586Object22/06/2002 10:31:33

Hola guapo!soy una chica de menorca que te quiere y admira mucho,solo queria hacerte la siguiente pregunta: ¿Vero y tu vendreis a menorca a dar algun concierto? es que me han dicho que si veniais pero en la gira de los conciertos no lo pone,me gustaria que me contestases y si venís,¿me podeis decir la fecha?bueno solo decirte que seguro que serás en un futuro no muy lejano disco de diamante,muchos besos.Noemi.

Object

587Object22/06/2002 10:33:19

HOLA DAVID!!! HABLE CON TU TIA ES UN CIELO SUPER SIMPATICA, LE DI MI TELEFONO PARA Q ME LLAMARAS TE LO HA DADO??. ESPERO Q SI,CNT!. LIDIA DE BARCELONA,NOS VEMOS EN PALAMOS!(EL HOTEL DND VAS A IR ESTA MUY BIEN NO?¿)JIJIJI

Object

588Object22/06/2002 10:34:18

HOLA BUSTA SOY UNA GRAN FANS TUYA QUISIERA SABER ¿CUANDO VAS A VENIR A MADRID A FIRMAR DISCOS, DONDE? CANTAS MUY BIEN Y ERES MUY GUAPO.FUI AL CONCIERTO EL 1 DE JUNIO EN MADRI Y FUE LA BOMBA SOLO DECITE QUE TENGO 11 AÑOS Y QUE ME SABIA TODAS LAS CONCIONES Y AL DIA SIGUIENTE ESTABA AFÓNICA. SI ERES ALGO MAS QUE UN AMIGO PARA GISELA DA IGUAL YO CREO QUE LOS 2 SOIS MUY GUAPOS CANTAIS GENIAL HACEIS UNOS COROS DE MUERTE Y HACEIS MUY BUENA PAREJA. TAMBIEN DECIRTE QUE TE HE HECHO LA PREGUnta de cuando vas a venir a firmar discos porque he ido a la firma de discos de todos los que han venido menos de manu porque no lo sabia.Tengo todos los dicos.MUCHOS BESOS, SALUDOS Y ESPERO QUE TENGAS MUCHA SUERTE EN LA MUSICA PORQUE TE LO MERECES.BESOS MARTA(MADRID)

Object

589Object22/06/2002 10:35:01

hola Busta: Te escribo para decirte que eres el mejor con diferencia y para preguntarte si vas a actuar en Laredo.

Object

590Object22/06/2002 10:37:22

HOLA GUAPETON: ¿PORQUE NO HACES LA GIRA CON GISELA EN VEZ DE VERONICA?ASUN DE SEVILLA

Object

591Object22/06/2002 10:45:44

¡Hola David!Soy una paisana tuya que te quería felicitar por tu CD y por las grandes canciones que hay en el. Tambien me gustaría hacerte una pregunta: ¿Qué siginifico para ti que Camilo Sesto te eligiera para componer una canción por primera vez a un cantante que no fuera el mismo?Besos, Alicia

Object

592Object22/06/2002 10:50:02

¿estas con gisela o has encontrado ninguna?gisela es muy maja te aconsejo que te vayas con ella? ¿donde vas a ir estas vacaciones? besos nadia de una gran fan tuya

Object

593Object22/06/2002 10:50:11

Hola David, soy una fan de Tarragona, eres una persona encantadora, agradable, sencilla,tierna, cariñosa,autentica eres lo mejor q hay en este pais. Te quiero decir q eres el mejor y q no sabes cuantas emociones he pasado contigo. Te kiero con lokura incluso a veces pienso si algun dia podre conocerte, ese seria mi gran sueño. Q sepas q desde el primer dia ya tengo tu disco y las entradas para el concierto de Roda de Bera. Siempre he deseado conocerte perro nunca tengo la oportunidad y eso me da mucha rabia!Me da mucha envidia q muchas chikas te puedan conocer y yo no, eso es tener muy mala suerte! Ah por cierto, vas a firmar los discos en Roda de Berà (Tarragona)?. Ojala eso fuera posible, seria lo mejor pk asi podria almenos darte dos besos y hacerme una foto contigo pk esq te amo. Si vieras mi habitacion dirias q estoy loca pk tengo toda la habitacion llena de posters tuyo y de fotos, pero esq estoy loca pero de amor por ti. Una vez estuve en el chat de operacion triunfo, y se me conectro uno diciendo q era alex pero no se si es cierto, y yo le estuve explicando q mis favoritos soys el y tu, pero con mucha diferencia tu, y me estuvo contando q tu estuvistes por los sueles diciendo ME CAGUEN DIEZ jejee, pero lo q no se si es cierto. Si es verdad, soy aquella chika q se hace llamar amo-busta y q escribbire a la dicreccion de academia de artistas paq sepas lo mucho q te quiero. Me gustaria saber una vez por todas si ya tienes el disco de diamante, pk unos dicen q si y otros q no, si no lo tienes no te preocupes pk pronto lo tendras, pk lo q no haces tu no lo hace nadie. Sabias q lo tengo todo de ti? pues es cierto. Y te recuerdo q soy de tarragona, me llamo Mercè y tengo 16 años. BESOS!! TE KIERE UNA FAN Q ESTA LOQUITA POR TUS HUESOS! Esto va para ti: Anoche, pensando en ti, cuando más te adoraba, vi un mago en mi ventana.Auque no me dijo nada, tan solo con su magia , dijo lo q me pasaba. Bajo un cielo estrellado y en una brillante alfombra, llegue a un lago encantado con unas flores preciosas. Te divisé a lo lejos y se iluminó mi cara, te dirijiste hacia mi y te colastes en mi alma. Bomboncito, cielo, ya no se como puedo expresar mis sentimientos hacia ti, pk esq tu ya no tienes palabras, eres lo mejor de todo. TE KIEROOOOO . Ademas eres wapisimo y encima cantas de maravilla. bueno adios se despide tu amiga y fan numero 1. MERCÈ.

Object

594Object22/06/2002 10:52:42

wenas! ¿cuando vienes a firmar discos a mataro park? si vienes seguramente haré 2 cosas: o no me atrevire a subir o llorare. Aun asi espero ke vengas pronto. MUCHOS BESOS!! yo ya tengo una pancarta o sea ke tienes ke venir. xd! ERES EL MEJOR!!!!

Object

595Object22/06/2002 10:54:14

HOLA WAPIXIMO! una cosa: cuantas copias llevas? es ke me dijeron ke llevavas 800.000 pero n lo se. HAVER KUANDO VIENES A FIRMAR DISCOS A MATARO COMO LA FERGO! muchos besos!! eres el mejor! gemma

Object

596Object22/06/2002 10:54:31

aves q tienes muchas xicas enamoradas?

Object

597Object22/06/2002 10:57:18

llevo toda la mañana escribiendote preguntas para ke me cojan alguna y ahora no se me ocurre ninguna... VEN A FIRMAR DISCOS A MATARO!! ya tengo "una pancarta" echa por mi o sea ke n me puedes fallar!! muchos besos!! eres el mejor!! P.D sabes ke? mi madre dice ke eres como su hijo pk ve mas fotografias i cosas tuyas ke de nosotros... hasta tengo la alfombrilla para el raton... venga adios Y NO CANVIES NUNCA!! ENTONCES TRIUMFARAS!

Object

598Object22/06/2002 10:59:55

HOLA DAVID,SOY ALICIA,DE SANTANDER.TE ADMIRO MUCHO Y ME GUSTARIA SABER QUE ES LO QUE TE PROPONES PARA EL FUTURO.YA QUE SE QUE LE TENDRAS MUY BUENO.BESAZOS ENORMES:ALICIA FRANCO

Object

599Object22/06/2002 11:16:43

Pasará su gira por Córdoba.

Object

600Object22/06/2002 11:17:17

¿que nos puedes adelantar de tu gira de verano?

Object

601Object22/06/2002 11:19:40

bustamante q harias capaz de hacer por tus fans?soy noelia de malaga te quiero bueno te queremos españa entera

Object

602Object22/06/2002 11:23:54

hola soy mireia una muy fan tuya ,primero decirte que estas muy bueno teuqito mucho - el dia del concierto a palamos sacaras a alguine en el asenario?

Object

603Object22/06/2002 11:24:39

¿tu sueño fue ser artista y lo has conseguido el mio conocerte en persona crees q se hara realidad alguna vez? te quiero guapeton ese cantabro

Object

604Object22/06/2002 11:27:03

uno de mis sueños es conocerte si se hiciera realidad ya no me importaria morir seria capaz de cumplir mi sueño? yo creo q si por ti fuera si harias mi sueño realidad pq eres lo mejor.soy noe de malaga

Object

605Object22/06/2002 11:29:23

k has tenido que hacer para llegar a donde has yegado porque yo quiero lo mismo que tu aunque tengo la mitad ganado en amigos quiero una yamada tuya porfa me hacia ilusion grasias yaiza canarias 679693445

Object

606Object22/06/2002 11:30:46

eres el mejor sin duda y gisela tmbien ¿porke no aceis la gira juntos tu y gisela? soys la mejor pareja tanto sentimental como artistica t kierrooooooooooo!!!!!!!!!!!!

Object

607Object22/06/2002 11:31:47

ERES EL MEJOR! GUAPO GUAPO Y OLE! ...SI NO TE CONOCIERA, SI NO ESTUBIERA AQUI, NO HABRIA ENCONTRADO LA ALEGRIA DE VIVIR... GRACIAS POR TODOS ESOS RATOS QUE ME HAS ECHO PASAR TAN BONITOS...MUCHAS GRACIAS DE TODO CORAZÓN. *SARA* (BARCELONA)

Object

608Object22/06/2002 11:32:22

hola busta, kiero decirte k te kiero mas k a mi vida y k ojala tu luz brille por siempre, pork tu te mereces eso y muchiiiiiiiiisimo mas, ahji va mi oregunta: vas a venir d gira a Asturias esk en unos sitios dicen k si y en otros k no, y dnd se compran las entradas??? un beso GUAPISIMO!!!! SIEMPRE TE QUERRÉ!!!!!! LUCÍA

Object

609Object22/06/2002 11:33:01

cuantos discos llevas vendidos david?

Object

610Object22/06/2002 11:34:27

estas con gisela?¿

Object

611Object22/06/2002 11:36:16

no vas a pasar por barcelona en tu gira??

Object

612Object22/06/2002 11:37:31

Busta, como te sientes ahora que ya eres un artista?¿

Object

613Object22/06/2002 11:38:15

hola david m llamo itziar soy una fan tuya d bizcaya y quiero q sepas q m gustas desde el principio, pero quisiera saber porque en tu gira por España no t pasas por aqui cerca.Espero q todo t valla bien y q llegues al disco d diamante, un beso y agur.

Object

614Object22/06/2002 11:40:05

Busta, como te sentiste cuando reciviste tu primer disco de diamante?¿ Espero que muy emocionado y ojala te lo pudierapreguntar muchisimas mas veces. Besos ¡GUAPETON! de una catalana

Object

615Object22/06/2002 11:41:18

Hola Busta me llamo Raquel, eres el mejor enhorabuena por tu disco, me encanta. Mi pregunta es: ¿con que canción de tu cd te sientes más identificado? Mucha suerte te mereces lo mejor

Object

616Object22/06/2002 11:42:06

bustamante vienes a huelva alguna vez porfavor contesta

Object

617Object22/06/2002 11:43:25

Hola Busta soy Virgi una chica de Venezuela!!! lo que te queria preguntar es que si crees sea posible que vengas a Venezuela. Por cierto antes solo tenia a un idolo ahora tengo a dos, Ricardo Arjona y TU!!!!!

Object

618Object22/06/2002 11:44:51

HOLA DAVID!! QUE SENTISTE EN EL MOMENTO QUE DIJO TU NOMBRE PILAR TABARES PARA SER FINALISTA DE OPERACION TRIUNFO,Y SABER QUE TENIAS LA OPORTUNIDAD DE IR A EUROVISION?

Object

619Object22/06/2002 11:45:07

¿¿¿¿¿como ha de ser una chica para conkistarte se ha de parecer a gisela????t kieroooooo

Object

620Object22/06/2002 11:45:39

hola bustamante como estas soy estefania tengo gana de conocerte vas a venir a huelva en tu gira porfavor ar todo lo posibler por venir

Object

621Object22/06/2002 11:49:27

bustamante tu disco es fantastico me encanta porfavor un dia que no estes ocupado me puedes llamar esque tengo gana de escucharte estas buenisimo tengo 10 años soy de huelva y mi telefono es 959801880 porfavor contestame a mi correo estefaniabueno@ono.com te lo pido porfavo llamame tio bueno

Object

622Object22/06/2002 11:51:34

Hola Busta ¿q tal? enhorabuena por tu cd es genial,el mejor que he escuchado nunca. En las listas de conciertos que han sacado ¿puede haber modificaciones? ¿puedes añadir alguna ciudad más? es que Zaragoza no sale y me extraña. Suerte y espero que al final vengas. Raquel

Object

623Object22/06/2002 11:51:40

Hola Busta soy Yoli de Asturias(Oviedo). ¿Vas a venir algún día a oviedo a firmar autógrafos?

Object

624Object22/06/2002 11:51:55

que te parece Gisela? Pero no como amiga

Object

625Object22/06/2002 11:53:23

¿¿¿¿¿como consigues estar tan buenorro y ser tan buena persona a la vez?' eres el tio 10

Object

626Object22/06/2002 11:53:52

hola bustakmante!!! eres mi preferido y te queria preguntar una cosa: Cuando vendras por figueres y a llança? un besazo guapo

Object

627Object22/06/2002 11:54:40

Hola Busta q tal? enhorabuena por tu disco, me encanta. De San Vicente de la Barquera ¿que lugar considerarias más bonito? Suerte y sigue asi. Raquel

Object

628Object22/06/2002 11:55:57

david lo primero eres el mejor campeon pero me gustaria preguntarte si vas a venir a firmar discos a malaga por favor ven que aqui mucha gente quiere verte muchos besos campeon (azahara,malaga)

Object

629Object22/06/2002 11:56:16

¿que sentiste la primera vez qu ete subiste a un escenario?

Object

630Object22/06/2002 12:00:32

¿como te sientes al cantar con tantas personas delante tuya?eres el mejor busta.Isa mallorca

Object

631Object22/06/2002 12:00:39

hola busta me llamo anabel y soy fan fan de tuya me encantas como persona como artista y como todo lo qe he visto de ti,te quiero muchisimo te deseo toda la suerte del mundo y mas.eres el mejor y vales absolutamente para todo cantar, bailar, hacernos reir, emocionarnos etc.. bueno gracias por estar un ratito con todos nosotros un besazo. HASTA OTRA TE QUIERE TU FAN:anabel

Object

632Object22/06/2002 12:02:24

hola Wapisimo!!! como escribo desde inglaterra te queria preguntar si algun dia sacaras un disco aqui??? yo lo compraria seguro! con ese arte que tienes!! olee! un besazo de cristina x

Object

633Object22/06/2002 12:02:33

Que cancion del disco prefieres? no digas todas,por favor,elige una o dos.

Object

634Object22/06/2002 12:02:56

hola Wapisimo!!! como escribo desde inglaterra te queria preguntar si algun dia sacaras un disco aqui??? yo lo compraria seguro! con ese arte que tienes!! olee! un besazo de cristina x

Object

635Object22/06/2002 12:04:00

¿Que opinas sobre los artistas que os critican?

Object

636Object22/06/2002 12:09:29

crees que dentro de un año o los que sean se acordaran de ti? y cuantos de los 16 crees que duraran mas de un año?

Object

637Object22/06/2002 12:12:30

hola busta¡¡¡¡te acuerdas de la chica que te dio aquel peluche que era un gato y habia como un diario?

Object

638Object22/06/2002 12:13:28

Me encanta oir tu disco, pero también me gustaría verte,pero ni todos juntos, ni en tu gira individual pasas por Bilbao ¿por qué?¿pasarás alguna vez? Por favor estoy desesperada.Nerea(bilbao)

Object

639Object22/06/2002 12:13:28

os haceis piques entre vosotros sobre quien vende mas discos?cuentanos alguna anecdota sobre esto.mandame un besito porfa guapo TE QUIEROOOOOO BUSTAMANTE DISCO DE DIAMANTE

Object

640Object22/06/2002 12:14:06

como ha influido esto en tu vida? soy nuria de zaragoza y estoy loca por ti, me gustaria porder verte algún dia,seria mi gran ilusion.BESOSSS

Object

641Object22/06/2002 12:16:20

¿CUANDO DARAS EL CONCIERTO EN CASTRO?PORQUE ME ENCANTARIA IR PARA CONOCERTE.SOY TU FAN NUMERO 1 Y COMO DICE ESA CANCION... CANTABRIA LA TIERRA QUE ME VIO NACER...TOMA MI NUMERO 686419067 A VER SI ME LLAMAS Y POR FAVOR DIME CUANTO ANTES LA FECHA DEL CONCIERTO.AUPA CANTABRIA!!!

Object

642Object22/06/2002 12:16:49

Hola Busta¿Cual es el tipo d musica q mas t gusta cantar?¿Cuanto tiempo vas a sperar para sacar tu proximo disco?Q sepas q aqi tienes a tu fan 1ºq siempre t estara apollando.1besazo.Mucha suerte.

Object

643Object22/06/2002 12:17:56

Bustamante,en la academia te lo pasabas muy bien pero.¿que tres personas te dolio mas que se fueran de la academia?una fan de todos lo 16.

Object

644Object22/06/2002 12:17:58

es verdad que gisela y tu estais enrollados?? sois novios?. que tal lo pasastes en la academia?. que tal te llevas con Alex y Rosa??

Object

645Object22/06/2002 12:18:42

David:Cuantos discos llevas vendidos realmente? El dia del Festival de Eurovision, Carlos Lozano te dio la noticia de que habias vendido mas de 500,000 discos en tres dias. De eso ya han pasado casi cuatro semanas.Si sabemos que llevas vendidos muchisimos mas que esos, porqué Vale Music no te da los platinos que te corresponden? Tu disco es precioso, te queremos. Mary.

Object

646Object22/06/2002 12:18:56

David¿que sueño te queda aun por cumplir?¿Ahi algo que despues de esto aun no hayas echo?

Object

647Object22/06/2002 12:19:09

¿cuales son tus giras y por donde?¿iras solo o acompañada por algun/a compañera tuyo/a?Manda un saludito a ANA SERRANO de algeciras,por favor!Te deseo muxisima suerte con tu disco y espero verte por aki de nuevo.MUXOS BESOS DE UNA FANS KE TE QUIERE MUXO!!

Object

648Object22/06/2002 12:20:09

¿cual de los profesores de la academia,era tu favorito?¿te gustaria hacer un duo con Manu o con Nina?

Object

649Object22/06/2002 12:20:53

Mas que una pregunta keria dedicarle esta poesía. Con ganas e ilusion a un casting te presentaste y que sorpresa te dieron al seleccionarte. Llegaste a la academia y enseguida destacaste con tu sensibilidad y alegría pronto te acomodaste. Y las Galas empezaron y empezamos a admirarte viéndote cada día con entrega y con coraje. Y fuiste ganando Galas y cogiendo mucho arte para cantarnos a todas y así nos enamoraste Espero que aunque no ganes pues para mí ya ganaste el día que a la tele tu cuerpo tú asomaste. P.D.Echa antes d que tú sueño y el d todos se hiciera realidad.Vendras el 3 d Septiembre a Zaragoza? T kiero.Natalia.Zaragoza

Object

650Object22/06/2002 12:20:56

david ¿cual es la cancion favorita de tu disco?

Object

651Object22/06/2002 12:22:11

Cuando y donde haras la firma de discos?en barcelona=?te quiere

Object

652Object22/06/2002 12:22:14

Hola David! Te quiero felicitar por ese pedazo disco q has sacado! ES LA BOMBA! ¿Este disco es lo q tu soñaste toda tu vida? Una gran admiradora tuya. Con cariño: Aintzane (azpeitia, guipuzcoa, pais vasco)

Object

653Object22/06/2002 12:22:59

como es q siendo sevilla una de las ciudades mas importantes,no agas aq ni un concierto?????no lo puedo entender

Object

654Object22/06/2002 12:23:17

hola Busta.soy Mirian d Fuenlabrada (Madrid),me encanta tu disco,para mi es el mejor disco que ha habido en mucho tiempo,¡FELICIDADES!.Te queria preguntar si vas a pasar por aqui por Madrid en tus conciertos de este verano?.un besazo muy fuerte y no cambies nunca.

Object

655Object22/06/2002 12:26:12

¿Es verdad que tienes una tia en zaldibar, en Bizkaia?

Object

656Object22/06/2002 12:27:18

hola david!!solo decirte que me identifico mucho con tus canciones, gracias por esos momentos.¿que le gusta mas a un cantante que lo admiren por su musica o por su persona?besos belinda

Object

657Object22/06/2002 12:27:24

¿TODAVIA QUIERES A GISELA COMO ALGO MAS QUE UNA AMIGA?

Object

658Object22/06/2002 12:27:39

Hola Busta, me gustaria saber si es verdad que vendras a Barcelona a vivir, es cierto?

Object

659Object22/06/2002 12:28:11

Busta, tu eres un chico encantador, un buen cantante y muy buen amigo. Pero, como crees que vosotros en tan solo 4 meses habeis tenido tanto exito. Soy una chica vasca y me gustaria que me dieras consejos de ser cantante, porque es mi afficción cantar y bailar. Eres fenomenal!

Object

660Object22/06/2002 12:28:31

que guapo eres busta de tu fan alba barcelona

Object

661Object22/06/2002 12:28:49

hola busta.soy sara de valencia decirte que eres el mejor y que cantas muy bien.¿que te gustaria ser en un futuro?

Object

662Object22/06/2002 12:31:07

porque no vas a venir de concierto a Granada?? vendras a firmar discos????un besazo guapo ke tienes un disco de oro, es cierto ke ya has vendido 1.500.000??

Object

663Object22/06/2002 12:31:27

Hola wapisimo! Por favor podrias decirme si es verdad ke pasaras x Zaragoza capital el 3 de Septiembre? M gustaría k pasaras x Zaragoza xo si no pasas te ire a ver a Alcañiz o Monzon así ke yo siempre estare ahí contigo!! Gracias x semejante disco.Natalia.Zaragoza

Object

664Object22/06/2002 12:32:02

Hola Busta: ¿Qué sientes al ver a toda esa gente desviviéndose por ti en los conciertos después de tener tú también a un ídolo? Un beso de la más bustamaníaca!! Sigue con esa naturalidad! Elena

Object

665Object22/06/2002 12:37:06

hola busta guapisimo. aunque como solista eres el mejor ¿te gustaría hacer algun disco a duo con Alex?. y sigue así, nunca cambies.

Object

666Object22/06/2002 12:37:13

busta,en el concierto de valencia bais a sacar a alguna fan?noemi

Object

667Object22/06/2002 12:38:32

hola bustamante yo soy un fan tuyo, tengo tu disco y cada vez que salga uno me lo comprare, cantas muy bien y eres un tio de p.m, te quiero hacer una pregunta estas invitado a scorpia central del sonido esta en igualada, me parece que javian ya bino preguntaselo. querras benir?? llama al 636255406 soy paleta como tu trabajo con mi padre mi tio y mis cuñados, espero que algun dia pueda cantar yo me encanta

Object

668Object22/06/2002 12:38:54

hola busta guapisimo. Aunque como solista eres el mejor ¿te gustaria hacer algun disco a duo con Alex?. me encanta "corazon espinado" y "dos hombres y un destino". Tu sigue asi, no cambies nunca.

Object

669Object22/06/2002 12:42:32

¿Por que no te dejas ver para las fans que estan locas por ti,nos arías muy feliz a todas?Digo a todas porque yo soy una de ellas.

Object

670Object22/06/2002 12:44:27

tengo posivilidades de que algun dia me quieras?

Object

671Object22/06/2002 12:44:39

hola Titin, Queria decirte que eres lo mejor que me ha pasado en mi vida!!! bueno a lo que iba, queria preguntarte ¿que sientes cuando hay millones de personas que lo mas importante paar ellas es verte a tí aunque sea un segundo?

Object

672Object22/06/2002 12:45:54

que es lo que sientes cuando estas en un trabajo tan duro, y de pronto pasas ha ser cantante y encima con tanta fama y tantos discos vendidos? yo tambien trabajo de albañil y me pongo en tu lugar pero no me lo puedo imajinar

Object

673Object22/06/2002 12:46:45

no quieres novia??? explicame la razon

Object

674Object22/06/2002 12:46:48

Hola David. Desde tu club de Fans queremos darte mucho ánimo, que eres el mejor.a ver una pregunta ¿la semana que has pasado en Cantrabria la has disfrutado como tu quisieras?

Object

675Object22/06/2002 12:47:05

De todo lo que has vivido durante estos meses cual sería el mejor y cual el peor momento? Aroa (Gijón)

Object

676Object22/06/2002 12:47:23

DAVID, CUANDO VAS A ACTUAR EN CASTELLDEFELS, YO NO ESTOY, ¿ME PODRÍAS DECIR OTRO SITIO EN BARCELONA PARA PODER IRTE A VER? TE QUIERO MUCHISIMO. SOY TU FAN NÚMERO 1.TE KIERE MARIA, BCN.

Object

677Object22/06/2002 12:48:00

Somos dos cantabras y te apoyamos,eres el mejor,estuvimos toda la noche en el concierto de torrelavega para verte.Sabemos que vas a venir a cantabria, tu tierra, pero nos gustaria saber si vas a ir a las fiestas de la patrona de Torrelavega,adios y mucha suerte,SARA y SANDRA.

Object

678Object22/06/2002 12:49:08

HOLA WAPO!cual será tu proximo single??

Object

679Object22/06/2002 12:50:05

Hola David! Soy una chica de San Sebastian y me gustaría que me dijeras que es lo que mas duro se ta hace de todo lo que te esta pasando. Bueno te deseo todo lo mejor y espero tener la oportunidad de seguir comprando tus discos dentro de muchos años. Agur

Object

680Object22/06/2002 12:50:35

Hola Busta!¿Que te ha parecido tu paso por la academia?Sandra.

Object

681Object22/06/2002 12:51:44

de donde eres

Object

682Object22/06/2002 12:52:08

yo soi del altet

Object

683Object22/06/2002 12:52:17

Sabemos que el resto de tus compañeros de Operación Triunfo van a hacer sus conciertos de verano con algun compañero y nos gustaria saber si tu vas a ir solo o acompañado.Gracias, te quiere cantabria y toda españaSandra y Sara.

Object

684Object22/06/2002 12:52:40

estas muy bueno te quiero follar

Object

685Object22/06/2002 12:53:09

¿cuando piensas venir por la coruña?

Object

686Object22/06/2002 12:54:56

HOLA GUAPETON, SOY UNA FAN TUYA CIEN POR CIEN. ME GUSTARIA SABER SI ESTAS DE VERDAD CON GISELA YNO ME VALE DECIRME K ES UNA GRAN ARTISTA NI UNA GRAN AMIGA NI NADA ESO. NO DICES K POR TUS FANS HARIAS LO K FUERAS POS VENGA APLICATE GUAPETON, TE DESEO LO MEJOR Y ESPERO VOLVERTE A VER EN PERSONA QUE POR CIERTO ERES UN CACHO TIO..., BUENO TU FAN K TE KIERE Y TE ADMIRA!!!!!!!!!! LIDIA (GINESILLA)

Object

687Object22/06/2002 12:55:26

Busta, tu disco ha tenido mucho éxito, ¿te esperabas que tuviese tanto? Noelia (Elche)

Object

688Object22/06/2002 12:55:55

Vas a venir a Málaga a firmar discos?????y vendras de gira por Málaga?????Aqui te esperamos,no nos falles.un beso mu grande y que te vaya mu bien!!Lulú y Ali...

Object

689Object22/06/2002 12:56:28

¿Que sientes cuando ves toda esa gente que te apolla y te quiere? ¿Que son para ti los fans? Felicidades por tu disco. Te mereces todo lo que te esta pasando y mas

Object

690Object22/06/2002 12:56:41

hola david cuando vendras a dar algun concierto a leon ?tenemos muchas ganas de verte te queremos

Object

691Object22/06/2002 12:56:42

hola david cuando vendras a dar algun concierto a leon tenemos muchas ganas de verte te queremos

Object

692Object22/06/2002 12:56:57

Hola, soy una de tus muchas fans incondicionales que tienes. me supongo que sabras que tus fans te seguiremos apoyando pase lo que pase, y nada preguntarte que cancion de tu c.d te gusta mas. A mi todas pro hay alguna para ti mas especial q otra???gracias 1 besazo!!!!!

Object

693Object22/06/2002 12:57:17

HOLA GUAPETON!!! Cuando entraste en la academia, como te imaginabas el futuro? Que sientes cuando estas delante de todo ese público que te apoyamos? Mucha suerte y no cambies nunca. Un beso de Mary (Badalona)

Object

694Object22/06/2002 12:58:11

hola david guapisimo ¿cuando vas a dar algun concierto en León ?te quiero muchisimo muchos besos guapisimo

Object

695Object22/06/2002 12:58:11

Hola campeon! Cuando entraste en la academia, como te imaginabas el futuro? Que sientes cuando estas delante de todo ese público que te apoyamos? Mucha suerte y no cambies nunca. Un beso de Mary (Badalona)

Object

696Object22/06/2002 12:58:15

HOLA BUSTA, SOY 1 CHICA DE BILBAO Q TE QUIERE MUCHO, PORQ NO VIENES EN TU GIRA CON VERO POR BILBAO, ME GUSTARIA CONOCERTE ALGUN DIA PORQ ERES ESPECIAL PARA MI, AYESA

Object

697Object22/06/2002 12:58:31

Hola David! Soy una chica de San Sebastian y me gustaría que me dijeras que es lo mas duro que se te esta haciendo de todo lo que te esta ocurriendo. Bueno te deseo todo lo mejor y espero seguir teniendo la oportunidad en muchos años de poder ir comprando tus discos. Agur LEIRE

Object

698Object22/06/2002 12:59:03

Simplemente queria mandarte un saludo porque eres el mejor cantas como nadie y con la mano en el corazon para mi eres el numero 1 no cambies¡¡guapo¡¡.un beso.lydia.

Object

699Object22/06/2002 12:59:49

hola!!!sabes cuantos c.d's llevas ya vendidos????me lo podrias decir??gracias!!!te queremos(todas tus fans)

Object

700Object22/06/2002 01:00:09

hola bustamante q tal te sientes al saber q as vendido muchos discos ahora mismos a quien le darias las gracias. un beso de tania q eres muy guapo y muy buena gente.

Object

701Object22/06/2002 01:00:25

¿cuando vas a venir a león?

Object

702Object22/06/2002 01:00:39

hola guapo,soy patricia,tengo 15 años,soy de cadiz,me encanta como cantas y tu personalidad,te deseo muhca suerte,dime ¿es facil meterse a este mundo de la cancion?,lo digo porque a mi me gustaria ser algum dia cantante a que valgo para esto y me encanta y es mi sueño,muchas gracias

Object

703Object22/06/2002 01:01:44

Enhorabuena por tu disco David , es una maravilla. Sólo quiero decirte que al igual que os dijo Mónica Naranjo ya en la academia, búscate un buen abogado y que no te expriman demasiado.Besos. Viva Cantabria.

Object

704Object22/06/2002 01:03:10

el domingo boy ha la isla fantasia a ver formula abierta, natalia y naim, en santa margarida de montbui a chenoa y bisbal, tengo todos vuestros discos de todas las galas, soys mis mejores amigos pero vosotros no me conoceis asi que eso no se puede decir pero si estays interesados llamar un amigo que os apoya y os sigue siempre, 636255406

Object

705Object22/06/2002 01:03:49

Hola Busta. Me podrías decir cuando empezará tu gira??? Muchas gracias wapetooooon.(Soy Soraya, la del messenger)

Object

706Object22/06/2002 01:04:14

q lunes?

Object

707Object22/06/2002 01:04:38

hola guapo en tu gira en solitario vendras al tivoli de malaga? es que necesito saberlo mucha suerte en tu carrera y muchas gracias un beso guapisimo.

Object

708Object22/06/2002 01:04:44

Bustamante,vas a venir a firmar discos a Madrid???si es asi cuando seria????te keremos.de elena y lorena.acuerdate de nosotras

Object

709Object22/06/2002 01:05:07

Hola David, soy Olga de Madrid. ¿Porqué no se incuyó en tu álbum la canción que escribió Marcos Llunas para tí?

Object

710Object22/06/2002 01:05:55

hola david soy yoli queria decirte que te quiero mucho y ya depaso respondeme a esto si puedes: ¿que tal llebas la vida de fama? ¿que es lo mas gracioso que te a sucedido en la gira,galas? bueno gracias y mucha suerte tu si eres un campeon

Object

711Object22/06/2002 01:06:01

hola wapisimo nos podrias decir cuantas copias llevas vendidas? un beso

Object

712Object22/06/2002 01:06:36

busta vas a venir a firmar discos a madrid????Si es asi cuando??te keremos.de elena y lorena.eres el mejor

Object

713Object22/06/2002 01:08:36

Hola David!! ¿¿Qué es lo que más te gusta de tu popularidad?? ¿¿Cambiarías algo?? Muchos besos compañero!! Tamara ¡¡Busta te quiero!!

Object

714Object22/06/2002 01:12:00

¿Qué sentiste cuando Gisela te desbrochaba la camisa en el ensayo de su canción para una gala?

Object

715Object22/06/2002 01:13:05

Hola David, me llamo Tamara, tengo 14 años y queria preguntarte a que sitios vas a ir a realizar una firma de discos. Muchas gracias. Nunca cambies.

Object

716Object22/06/2002 01:14:30

¿te queda algún sueño por cumplir todavía?

Object

717Object22/06/2002 01:14:36

hola!!soy una fan tuya y me gustaria saber cuando vas a venir a firmar a madrid.bueno solo decirte q eres el mejor y q no cambies nunca.1 bsazo d tu fan numero 1.TE KIERO MUXO CAMPEON.LAURA PARLA(MADRID)

Object

718Object22/06/2002 01:15:32

Hola Busta, ¿¿te gusta la idea de que Vero cante contigo en los conciertos?? Muchos besos, eres el mejor!! -Tamy

Object

719Object22/06/2002 01:15:49

Davi el dia 6 vas a Roda de Bara , vas a visitar Tarragona?? lo digo por que soy de alli y pienso estar en el concierto viendote MUCHOS BESOS de tu tarragonina

Object

720Object22/06/2002 01:16:12

bustamante, crees que si no hubiese sido por operacion triunfo, realmente habrias podido alcanzar tu sueño? Esta clarisimo que te lo mereces porque eres un artista de pis a cabeza, pero crees que habrian reconocido todo tu talento?

Object

721Object22/06/2002 01:16:29

hola guapisimo!! te quiero mas que a mi vida propia!! soy del foro _la_busta_ tengo 14 añitos, queria felicitarte por todo y decirte que eres el mejor y que te quiero muchiiiisimo.estaras en sanvi desde el 21 de agosto al 31?? es que me pasare uno de esos dias ;) ;) te quierooo guapiisimo

Object

722Object22/06/2002 01:16:47

¿es tu novia gisela?di la verdad y solo la verdad

Object

723Object22/06/2002 01:17:29

Realmente tienes mucho talento, eso lo emos podido comprobar todos y todas, pero en el disco de ahora no hay ninguna cancion tuya, mas adelante compondras algo, o lo tuyo no es componer?

Object

724Object22/06/2002 01:18:25

bustamante.Esta cuestion que te mando no es una pregunta sino para decirte que si me podrias escribir algun dia.yo aqui te mando mi direccion Ana Alfranca Calavia c/jardines de la concordia nº9 8ºa esc izq 50015 zaragoza . espero que tu vida haya cambiado mucho y que consigas muchos exitos besos

Object

725Object22/06/2002 01:18:42

Todos los concursantes ahora tienes una oportunidad enorme y tu tienes una de las mas grandes, en las listas de ventas vas segundo, detras de tu tocayo Bisbal, realmente crees que el es mejor que tu?

Object

726Object22/06/2002 01:18:53

ahora que has cumplido tu sueño tienes que estar super feliz, pero el sueño de mucha de tus fans es conocerte en persona, yo soi de malaga y desgraciadamente me quede sin entradas a ver si vienes otra vez, mi sueño es conocerte porque eres el chico mas guapo y tierno de todo el mundo entero

Object

727Object22/06/2002 01:19:23

Hola he visto tu gira y a donde vas a ir este verano , me ha decepcionado el q no vengas a huelva:¿vas a venir alguna vez aunque solo sea para firmar discos?Patricia.Huelva. UN gran besazo para ti wapo.

Object

728Object22/06/2002 01:19:27

cuando vas a actuar en san vicente de la barquera yo soy de barcelona y este verano ire a cantabria a ver la que es maravillosa y de paso si te podemos ver a ti mejor.gracias y un besazo.para el mejor.

Object

729Object22/06/2002 01:19:56

tus fans estan locas por ti, pero crees que son fans tuyas de las de toda la vida o simplemente son fans del chico guapo q es una novedad, temes que el publico se olvide de ti?

Object

730Object22/06/2002 01:19:56

¿como decidiste apuntarte a operacion triunfo?

Object

731Object22/06/2002 01:20:31

cuando te vas a ir a tu pueblo a vivir.un beso miriam de barcelona

Object

732Object22/06/2002 01:21:27

espero qu el lunes te oiga responder a mi pregunta.cuando vas a actuar en san vicente.1 besazo miriam de barcelona

Object

733Object22/06/2002 01:21:58

me llamo javi, soy fan tuyo. cuantos discos crees que venderas cuando salga a la venta el 2 disco? la respuesta la tengo yo venderas igual o mas te lo mereces, todo el mundo te quiere por tu forma de ser, por tu voz, por tus sentimientos y por todo. aprobecha esta opurtinada pq tienes a todo el mundo en tus pies no pq lo diga yo si no pq todo el mundo quiere a bustamante en especial... soys todos buenos ( pero la palabra mas oida es bustamante) de un colega que espera conozerte muy pronto vivo en igualada al lado del bruc donde vive guisela.

Object

734Object22/06/2002 01:22:24

Hola David. Me encanta tu disco, es precioso. Me gustaría saber cual de tus canciones te gusta más, pero no digas "Además de ti", dime otra. ¿Preferias hacer el duo con otra persona o con Álex, quizas un duo chico/chica con una de tus compañeras? Gracias por ser como eres y por tu música. Olga

Object

735Object22/06/2002 01:22:48

hola busta¡¡¡ k tal wapo?¿? soy una chica de malaga y keria decirte q te kiero mucho y q si algun dia podre conocerte y ya sabes: bustamante disco de diamante ¡¡¡¡ animo wapo y cuenta con el apoyo para siempre de tu amiga ali, un beso y dale recuerdos a todos tus compañeros q soys los meores¡¡¡ muakkk

Object

736Object22/06/2002 01:22:54

tu crees realmente que si no hubiera sido por las adolescentes con el movil habrias llegado a ser el tercer finalista? esta pregunta la hago y yo afirmo que si habrias llegado igualmente poruqe te lo merecias

Object

737Object22/06/2002 01:24:15

busta, soy una valenciana que te admira me podrias decir si ¿vas ha hacer algun concierto por aqui?

Object

738Object22/06/2002 01:25:06

Davi que tal??? pues que sepas que soy tu fan nº 1 de TARRAGONA , mira que sepas que tienes unos hermanos favulosos y una familia que ... alucinas!!!! Si esta pregunta sale , tu tio y hermano Manuel sabran quien soy , Ana Maria de Tarragona,TE DESEO QUE SIGAS EN LO ALTO MUCHO TIEMPO, yo te pienso ayudar y todo tu club de fans tambien, BESOS DE TU TARRAGONINA

Object

739Object22/06/2002 01:26:56

desde igualada, barcelona, te queremos para siempre. agrupación y seguidores de bustamante 7.000 personas en tus pies. que es lo que mas te gusta desde que has empezado con esto de la música????????

Object

740Object22/06/2002 01:28:16

primero decirte que eres un artistazo como la copa de un pino. ya sabemos lo de la cancion de Marcos Llunas, q paso realmente??te quiero.

Object

741Object22/06/2002 01:29:02

hola david soy leticia de bilbao. que tal llevas el exitazo que has tenido desde o.t?bueno mucha suertey espero que sigas triunfando tanto como lo estas haciendo ahora.

Object

742Object22/06/2002 01:29:48

Nas,David soy una chica de Cabezon de la Sal,como se te ocurre hacer tu concierto de SVB el dia antes de la montaña en Cabezon?

Object

743Object22/06/2002 01:30:36

bustamante eres todo para mi no como cantante (que no dudo que eres un buen cantante pq lo eres i demasiado),mi mejor amigo murio en un accidente de trafico i era igualito a ti i cuando te miro me recuerdas a el i me pongo a llorar.solo keria acerte llegar este mensaje pq para mi eres muy importante te kiero preguntar si vendras por menorca alguna vez?me alegraria mucho.Almenos mandame un beso.lidia menorca

Object

744Object22/06/2002 01:32:20

en la canción de tu disco "cuando hacemos el amor" ¿porque se te escapo esa risilla al final?

Object

745Object22/06/2002 01:33:42

Hola Bustamante!! ¿Qué le dirías a aquel o aquella que no ha dejado de creer en ti desde que te vio por primera vez y ahora ya cuando te ve te siente como algo suyo?

Object

746Object22/06/2002 01:34:39

HOLA CANTABRO,SABIAS QUE ADEMAS DE LLEGAR A TU GRAN SUEÑO PODRÍAS ALEGRAR LA VIDA A MUCHAS PERSONAS QUE DE MUY DE VEZ EN CUANDO LE DAN MUCHOS BAJONES???PUES SI, YO SOY UNA DE ELLAS, ME LLAMO SUSANA,TENGO 23 AÑOS Y SOY DE LEON CIUDAD EN LA QUE ESTUVISTES Y AUNQUE ESTUVE INGRESADA 5 DIAS PORQUE CASI ME QUEDE SIN GARGANTA ME ALEGRASTE LA VIDA...SIGUE ASI EN LO MAS ALTO MAS QUE NADA PORQUE NECESITO TU MUSICA, TE NECESITO A TI........ QUE CANCIÓN O ESTRIBILLO ME DEDICARIAS A MI, UNA CHICA QUE ESTA ALEGRE UN DIA Y EL RESTO CASI POR LOS SUELOS SIN ENTENDER PORQUE TENGO TAN MALA SUERTE PARA TODO????????? COMO ME GUSTARIA COMPARTIR UNA GRAN AMISTAD CONTIGO, LA UNICA PERSONA QUE EN MUCHO TIEMPO ME HA HECHO SONREIR!!!!!JAJAJAJAJAJAJAJAJAJAJAJAJJAJA SE QUE JAMAS TENDRE CONTACTO CONTIGO PERO MI CORREO ES CYBER1598@MIXMAIL.COM................... A MI TAMBIEN ME GUSTARIA QUE AL DESPERTAR UNA NUEVA MAÑANA ESE DÍA FUERA EL MAS IMPORTANTE....... HASTA MUY PRONTO MI ALEGRIA DE VIVIR "DAVID BUSTAMANTE". SUSANA FERNANDER GARCIA DE LEÓN.

Object

747Object22/06/2002 01:34:47

bustamante porque ademas de ti y no otra para tu singel? personalmente me gusta mucho venga mi niño maria

Object

748Object22/06/2002 01:35:52

Hola Bustamante!! Todos esperamos poder seguirte viendo pero tenemos miedo de perder al Bustamante que conocemos y tanto queremos. ¿Qué nos dirías a todos estos? Un abrazo enorme!

Object

749Object22/06/2002 01:36:52

ola David, ya sabemos k contigo y gisela no hay nada, xo podra haber algo, pq vienes a vivir en Barcelona no? tiene algo k ver con ella?

Object

750Object22/06/2002 01:38:30

hola david,en 1ªlugar eres el mejor y el mas guapo.me gustaria saber si el concierto que vas a dar en pola siero va a ser gratis,bueno,espero k sigas asi y que vendas muchos discos.besos de una fan de asturias iris.

Object

751Object22/06/2002 01:39:50

hola busta! somos michelle y eva de palma de mallorca y queremos darte nuestro numero de movil para que nos escribas aunque sea solo un mensaje. sabemos que mucha gente te habrá propuesto esto pero tenemos la esperanza de que nos contestes. eva:676726591, michelle:620696069.cuando harás un concierto en palma de mallorca? tenemos ganas de verte. nos gusto mucho el especial Bustamante y amigos, no nos perdemos nada de ti. suerte en tu carrera...........besos................

Object

752Object22/06/2002 01:40:02

BUSTAMITE SOY UNA FAN TULLA ME GUSTARIA ME MANDES UNA FOTO

Object

753Object22/06/2002 01:40:35

¿Cuándo darás un concierto en Barcelona ciudad?Gracias y enhorabuena por el éxito.

Object

754Object22/06/2002 01:44:14

hola David soy Noelia de Loja un pueblo de Granada y me gustaria saber porque no haces ningun concierto en Granada

Object

755Object22/06/2002 01:45:33

Bueno David, ante todo muchas felicidades por tu disco! Ya estoy ansiosa por veros a ti y a Vero en directo, hoy mismo he comprado mis entradas para veros en Palamós. Queria preguntarte: Que propaganda te harias de tu disco, si tuvieras que hacerlo, como lo definirias? Lo digo para la gente que aun no lo tiene, porque a mi no me tienes que hacer ninguna propaganda, es buenisimo tu disco. Suerte en la vida David. Un besito. Laura.

Object

756Object22/06/2002 01:46:26

¿me puedes decir como es tu tierra ? es que me gustaria ir este verano a la tierra de mi idolo de beatriz para bustamante

Object

757Object22/06/2002 01:46:31

Hola Busta : En la revista Sorpresa sale que tu eres novio de Gisela.¿es verdad? De una Libra.

Object

758Object22/06/2002 01:47:25

hola busta como llevas lo de ser famoso te keremos las conquenses

Object

759Object22/06/2002 01:48:48

hola wapeton! ¿tienes miedo a que dentro de unos años se te acabe la popularidad y nadie te conozca?Aunque para eso estamos tu foro,tu club de fans...para apoyarte siempre.¡suerte! patri,alicante.

Object

760Object22/06/2002 01:50:00

Hola Tintin: ¿Quien es tu mejor amiga? De Isabel(Cantabria ).

Object

761Object22/06/2002 01:50:10

que te ha parecido la grabacion de tu disco? ya vemos que te ha quedado de vicio.Mucha suerte y a por todas.Patri

Object

762Object22/06/2002 01:50:50

busta cuantas copias has vendido q sepas q eres el mejor del universo y yo por ti daria mi vida sarai X busta sarai tu fan catalana n 1

Object

763Object22/06/2002 01:57:09

muy buenas! ya sabemos que gracias a operacion triunfo,todos habeis saltado a la fama. Si no hubieras entrado a la academia,como habrias intentado saltar al mundo de la musica? Te esperamos en tu foro.Besos

Object

764Object22/06/2002 01:58:10

busta vas a venir a marbella a firmar disco??? por fa ven k estoy lokita por ti eres mi idolo y te kiero mas k a mi vida!!!!

Object

765Object22/06/2002 01:59:38

¿Pasaras en algun concierto por Valladolid? en pucela te queremos mucho un beso guapeton.Te deseo lo mejor. Ana

Object

766Object22/06/2002 02:03:56

Al final vas a firmar discos o lo habeis cancelado.

Object

767Object22/06/2002 02:06:53

hola corason! tu sabes lo que se siente al ver a un idolo tuyo, cuando vistes a Cristian etc, entonces entiendes las locuras que hacemos para poder veros?!! te agobia o te gusta? que es lo mas fuerte que has hecho por ver a uno de tus idolos? te queremos un monton, SUERTE!

Object

768Object22/06/2002 02:06:57

¿ que es mas dificil cantar para una persona o para 6000? soy tu fana Nº1

Object

769Object22/06/2002 02:08:01

Si te dijeran pide tres deseos q te seran concedidos,que pedirias??

Object

770Object22/06/2002 02:11:46

Hola corason,un saludo desde tu foro que te quiere y te apoyará siempre.Esta es mi pregunta:¿qué es para tí la felicidad en este momento? ¿te consideras una persona feliz? Muchos muchos besos. Scruly

Object

771Object22/06/2002 02:14:00

hola campeon! cual es la cancion que mas te gusta de tu estupendo disco? te gusta la idea de ir de gira con vero? es fantastico,ya veras como llenais todos los lugares a donde vais.Te esperamos en alicante.Muchos besos.

Object

772Object22/06/2002 02:16:56

Crees ke podria existir el amor entre ídolo y fan??? 1 BESAZOOO PA' EL + WAPOOOOO DE TOA' CANTABRIA..... PATRY Y MARTA......

Object

773Object22/06/2002 02:20:07

hola david me gustaria saber que prefieres en las vacaciones irte ala playa o quedarte en la ciudad un beso

Object

774Object22/06/2002 02:27:19

kaixo!(hola) sólo quiero saber¿por qué no vas a pasar por el País Vasco en tu gira? soy Vasca y me ha decepcionado un poco.Me gustaría también saber ¿cuántos discos has vendido exactamente?(no valen 5**). Musutxus Patricia(Bikaia).Que sepas que pa' mi eres el nº1 y vales mucho.

Object

775Object22/06/2002 02:57:20

como a sidfo t paso po operacion triunfo

Object

776Object22/06/2002 03:09:03

Irás a firmar dicos en Tarragona o alrededores? Si tu respuesta es afirmativa, podrias decir el dia, lugar y gora? Me encantas, me gustaria conocerte, ya que a tu padre le conoci en barcelona. Pobre le paré en la acera y le avasallamos con preguntas :) así que sólo me faltas tu!!!(OJALA)muchos besitos y muchisimaaaaaaaaaaaaa suerte.

Object

777Object22/06/2002 03:09:24

Irás a firmar dicos en Tarragona o alrededores? Si tu respuesta es afirmativa, podrias decir el dia, lugar y hora? Me encantas, me gustaria conocerte, ya que a tu padre le conoci en barcelona. Pobre le paré en la acera y le avasallamos con preguntas :) así que sólo me faltas tu!!!(OJALA)muchos besitos y muchisimaaaaaaaaaaaaa suerte.

Object

778Object22/06/2002 03:11:27

¿Cual es ese secreto confesable que tienes que todavia no conozcamos??? Un besito txurry

Object

779Object22/06/2002 03:14:06

Bustamante, me gustaría saber si iras a firmar los discos en Tarragona o alrededores (si la respuesta es afirmativa , ¿podrías decir dia, hora y lugar?) Muchisimas gracias campeónnn. AH! conpcí a tu padre en Barcelona hace dos meses así que sólo me falta conocerte a TI: Si es posible me encantaria. Muchos besos y un grabn abrazo. TE MERECES TODO EL EXITO QUE TIENES Y QUE TENDRÁS. TENGO SEGURO.Silviab (Tarragona)

Object

780Object22/06/2002 03:14:26

porque no haces ningun concierto solo o con vero en el palau sant jordi (barcelona)azlo porfavor que te quiero ver. wpo.marta te quiero

Object

781Object22/06/2002 03:15:10

hola david,me llamo blanca,soy andamia en tu foro de portalmix.Queria preguntarte lo siguiente: ¿¿por qué ya no muestras tus sentimientos como al principio del programa??¿qué has hecho para poder aguantar tantas emociones sin llorar??,a mi m encanta verte llorar,porque ahi se ve lo sentimental que eres.TQM david,gcias por hcerme feliz,eres lo que da sentido a mi vida.

Object

782Object22/06/2002 03:16:51

DAVID, SOY BEA, LA DEL HOTEL EN MADRID Y EN EL AEROPUERTO, DIME... ¿ES POSIBLE QUE PASE TU GIRA X MADRID CENTRO? UN BESO ENORME, YA SABES COMO TE QUEREMOS EN MADRID :)

Object

783Object22/06/2002 03:18:00

Hola guapeton!! Cual es tu cancion favorita d etu disco? Con q cd de ts compis te kedarias??? Tu disco es genial Melani de barcelona

Object

784Object22/06/2002 03:18:28

hola soy blanca,tengo 19 años y soy de sevilla,soy andamia en tu foro,david queria preguntarte ¿¿qué cosas son en las que te fijas en una mujer??,a ver si tengo suerte¡¡jajajaja.Queria decirte tambien que te quiero con toda mi alma y que me haces muy feliz.un beso amor¡¡¡

Object

785Object22/06/2002 03:18:37

Esos músculos son de gimnasio?

Object

786Object22/06/2002 03:20:20

¿cres que se te ha tratado bien dentro de la academia?

Object

787Object22/06/2002 03:21:50

¿que se siente de pasar de la noche a la mañana de los andamios al mundo musical?¿desde cuando deseas alcanzar este sueño? espero que te vaya bien el resto de tu vida y que tengas mucha suerte aunque con el "peaso" voz que tienes no creo que necesites mucha suerte ni que nada en la vida te vaya mal. un beso muy fuerte de una seguidora tuya.paki la sevillana

Object

788Object22/06/2002 03:22:41

hola david,soy blanca,una sevillana de 19 años,soy andamia en tu foro.Te queria preguntar si te acuerdas de mi y de mis 2 amigas que estuvimos en tu entrada en el hotel pza d armas d sevilla cuando fue el cncierto d OT.LLevabamos 2 pancartas y los pañuelos en la cabeza dl club,ese fue el momento mas feliz de mi vida y aunque no te pude tocar,te dije que te queria y tu nos tirastes besos y nos dijiste wapas,yo no he llorado mas d felicidad en mi vida, m temblaba todo.Solo queria darte las gracias cariño.Un beso fuerte,espero poder conocerte algun dia.TQM

Object

789Object22/06/2002 03:22:57

¿que sientes en tus conciertos? ¿te sientes en deuda con tus fans,por todo lo que te estan dando o crees que tu disco es una buena recompensa para ellos? ¿que sientes cuando ves a los fans llorando emocionados al verte? ¿y cuando te piden un autografo?

Object

790Object22/06/2002 03:24:10

hola david soy blanca,soy de sevilla,tengo 19 años y soy andamia en tu foro de portalmix.¿¿vendras a sevilla a firmar discos algun dia???aunke sea en tu 2º disco??????'un beso cariño,t quieroooooooo¡¡¡¡

Object

791Object22/06/2002 03:25:30

¿cual es la cancion de tu disco que mas te gusta,o no puedes elegir una porque todas son especiales? ¿que es lo mas raro que te a pasado por la calle siendo famoso?¿y cuando no lo eras?

Object

792Object22/06/2002 03:25:45

soy una chica de sevilla que me encanta bustamante y quisiera saber cuando viene a sevilla en corcierto.un besote para el y que eres el mejor.

Object

793Object22/06/2002 03:29:59

bustamante eres el mejor si duda, y q sepas q siempre he estadoahi cntigo y no me arrepiento. y para reyes me voy a pedir uno como tu jejeje imposible busty solo hay uno

Object

794Object22/06/2002 03:34:03

hola david: me llamo blanca,tengo 19 años,soy de sevilla y me llamo andamia en tu foro d portalmix.Queria preguntarte si lees todas las cartas que te mandamos las fans de tu club,me haria mucha ilusion saber que has leido mis mails que te llevan los periodistas, y mi carta que le di a una amiga mia d los pases vips de sevilla,ya que dentro meti una foto mia para ti. T QUIERO NO CAMBIES NUNCA XFAVOR,mil besos d una fan k sin ti no es nada,xq ADEMAS D TI N HAY MAS. p.d:t regalamos una argoya y n t la hemos visto puesta,espero vertela,un besazo.

Object

795Object22/06/2002 03:35:09

bUSTa soy una fans tuya que te quiere mucho me gustaria saber si vas a venir a algeciras??porque en unas paginas viene que si y en otras que no.A mi me encantaria que vinieras me haria mucha ilusion y que sepas que tu compas eres el mejor

Object

796Object22/06/2002 03:35:52

¿si te pidieran cantar en hospitales ¿lo arias?

Object

797Object22/06/2002 03:35:55

Hola David!Ahora estás viviendo uno de tus mejores sueños, pero cómo te ves dentro de 10 años? Yo espero que sigas igual de sincero, y que sigas triunfando durante muchos años.Bsos. Patricia (Vitoria)

Object

798Object22/06/2002 03:37:03

hola david espero q sigas x el camino q vas pero ¿esperabas estos discos de platinos q t as llevado? ¿piensas q el verano q viene seguiras como vas? ¿Q es lo q a marcado operacion triunfo en tu vida? aunq creas q no, españa esta y estara contigo vayas como vayas. TODA SEVILLA ESTA CONTIGO UN BESO DE UNA SEVILLANA DE 12 AÑOS SANDRA

Object

799Object22/06/2002 03:37:04

Hola David.Solo queria felicitarte por tu disco y por esas fotos que has sacado en el disco,son geniales.Bueno mi pregunta es ¿Te gusta tu disco? ¿Que tal llevas lo de ser famoso?.PATRI

Object

800Object22/06/2002 03:37:39

hola mi niño, ¿vas hacer algun concierto en barcelona ciudad? ¿vendras a bcn a firmar los discos? es que quiero conocer al mejor cantante del mundo. tu fiel admiradora andyms

Object

801Object22/06/2002 03:37:52

¿Bustamante tus fan de tu club de fans como te puden ver dee verdad te lo pregunto porque a lo mejor tu lo sabes mejor que yo?un beso muy fuerte de tu fan Lorena,¡¡¡¡¡¡¡¡Tio buenooooooo¡¡¡¡¡¡¡¡¡¡

Object

802Object22/06/2002 03:38:23

Hola Busta! Ya que ultimamente estamos viendo tanto futbol, por los mundiales,me gustaria saber cual es tu equipo favorito, y tu jugador. Bsos. Yolanda

Object

803Object22/06/2002 03:38:31

hola wuapo¡¡¡mi pregunta es: cuando llamastes y fuistes a los casting,¿llegastes a pensar alguna vez que ibas a llegar hasta donde has llegado? tener un disco, vender mas de 500.000 copias, etc. un besazo FATIMA

Object

804Object22/06/2002 03:39:31

como ha sido tu paso por la academia?

Object

805Object22/06/2002 03:40:34

hola soy mercedes,titin tq en tu foro,no sé si te acoradaras pero soy la chica del pase vip de sevilla,que te pedi que me cantaras 2 hombres y un destino,si si¡¡¡la de la pancarta amarilla fosforito¡¡¡gracias por hcer de aquel dia el mas feliz de mi vida.Sbes algo de la firma de discos de sevilla?Como es que no vienes en tu gira aki???un beso fuerte,titin tq.

Object

806Object22/06/2002 03:42:14

Hola David,soy Noelia de Valladolid y me gustaría que vinieras a visitar la sede de la Casa de Cantabria aquí para que veas lo bien representamos a la tierra fuera de Cantabria,un beso y que sepas que eres el mejor pero que no se te suba a la cabeza porfa,sigue siendo como eres, un besazo

Object

807Object22/06/2002 03:43:26

David, ¿qué pasó con el duo que ibas a hacer con Sergio Dalma? Al final no le hemos podido ver en tu precioso disco

Object

808Object22/06/2002 03:44:09

¿piensas que los comentarios negativos sobre Operación Triunfo, no dejan ver por ejemplo,tu gran calidad de voz y tu calidad de artista? Los expertos es que no han calibrado tu disco excepcional?¿es que están mediatizados?

Object

809Object22/06/2002 03:48:22

Busta, en tu gira sabes si realizaras algún concierto por la Comunidad Valenciana?una fan.Silvia-Vall de Laguar-.

Object

810Object22/06/2002 03:48:29

Busta, ¿cuando vendrás por el país vasco? especialmente por guipuzcoa

Object

811Object22/06/2002 03:51:44

bustamante cuand estaras por cordoba soy cristina y estoy super enamorada de ti tu me has devuelto la vida t quiero mucho teng 18 años y me gustaria conocerte

Object

812Object22/06/2002 03:54:24

Bustamente te quiero decir que soy una gran fan tuya que tiene 21 poster tuyos y de tus compañeros la mayoría son tuyos y te quiero preguntar si ¿ sientes algo mas que amistad hacia gisela ? mi nombre es Aurora y vivo en Gijon

Object

813Object22/06/2002 03:55:57

hola cariño,soy blanca,soy de sevilla,tengo 19 alos y me llamo andamia en tu foro de portalmix,keria felicitarte x esa pedazo de familia que tienes,xq ns trata al club de fans fantasticamente,ada,tito,javier,roberto... tdos nos tienen super informados,y anima a tus hermanos a que se conecten en el foro con nosotros¡¡¡¡ya tus padres¡¡¡.un beso fuerte.

Object

814Object22/06/2002 03:56:30

Hola David.Me llamo Cristina tengo 11 años.Esta es mi pregunta:¿Con quien te llevas mejor de la Academia? Sigue así de guapo.Muchos besos de tú admiradora número 1.BESOS.

Object

815Object22/06/2002 03:56:45

Hola bustamante soy un gran fan tuya que te quiere preguntar con ¿ cual de tus compañeros te llevas mejor del sexo masculino que yo creo que es alex y del femenino que yo creo que es Gisela ? me llamo Aurora y vivo en Gijón

Object

816Object22/06/2002 03:57:21

hola guapo !!!!!!!!!!!!!!!! lo que se le excapo a Alex de que te gustava Gisela...era verdad ? haceis muy buena pareja !!!!!!! un besazo . silvia 12 años

Object

817Object22/06/2002 03:59:36

Hola busta eres mi favorito y te quiero preguntar si ¿ alguna vez te quedaste con el corazón roto por alguna mujer antes de tu paso por la academia ? guapo que eres muy guapo

Object

818Object22/06/2002 04:02:08

HOLA COMPAÑERU soy del foro mi nick es WENAGE, oye se de lo ocupado qu estás per ¿no crees que deberías entrar mas en el foro, ahi hay muchisima gente que te apoya, gracias hermano¡ wenage357@hotmail.com

Object

819Object22/06/2002 04:03:35

¿eres tan maravilloso como el la tele? ¿y en la intimidad? ¿en el amor te importa la edad? ¿por que eres asi de bueno guapo y sensible?

Object

820Object22/06/2002 04:03:38

hola wapo! cuando vendras a firmar discos a barcelona?? te estamos esperando campeon!!

Object

821Object22/06/2002 04:05:14

¿Que piensas acerca de la pirateria ? un besazo de una de tus fans.Aurora

Object

822Object22/06/2002 04:05:17

oye amigo soy WENAGE del foro ahi va mi pregunta: ¿se dice ultimamente que has cambiado un poco, que ya no eres el mismo que entro en la academia,es cierto eso?¿te pasa algo que deberias contar a tu foro que te comprende y conoce muy bien??, a tu lado nos sentimos seguros amigo.adios

Object

823Object22/06/2002 04:05:21

¿cuando irás a Valencia?

Object

824Object22/06/2002 04:06:57

Piensas que lo del mundial al igual que lo de eurovisión, debe de ser algo menos descarado y tiendan a desaparecer por su parcialidad. ¡Es una pena que tanto esfuerzo no sirva para nada y todo esté ya vendido! Besos y ¡mucha suerte! Ana de Melilla

Object

825Object22/06/2002 04:07:17

hola busta k tal?soy tu fan numero 1 me encantas estas muy bueno.Ante todo quiero que sepas que me gustas como persona porque eres un tio super simpatico.me gustraria saber si estas saliendo con gisela.mis favoritos sois tu y gisela (SOIS LOS MEJORES QUE TENGAIS MUCHA SUERTE OS LO MERECEIS)OS QUIERO UN MONTON A LOS DOS)GUAPISIMOS.ME LLAMO VERONICA.

Object

826Object22/06/2002 04:07:28

¿Por que elegiste además de ti como tu primer single ? ¿y cuaL será el segundo single? un besazo de Aurora

Object

827Object22/06/2002 04:07:33

Hola David, ¿ qué tal? bueno darte la enhorabuena por tu disco y por haber sido finalista del programa, quería preguntarte como te sentiste cuando quedó Rosa en el 7º puesto y quisiera también preguntarte cual es la canción que más te gusta de tu disco. Besos a todos tus compañeros y en especial a ti.Paula.

Object

828Object22/06/2002 04:08:16

Hola David.¿No hechas de menos a tu gente de San Vicente?, porque por lo que demuestras estas muy aferrado a todo eso.Sigue asi. Eres el mejor, cuidate. Un Besazo, wapísimo.

Object

829Object22/06/2002 04:09:03

Hola Busta, q tal? enhorabuena porque ya has vendido 500.000 copias de tu disco, besitos de mi parte pa ti.Marta.

Object

830Object22/06/2002 04:09:49

Hola David, lo 1º felicitarte por tu disco porque es genial, y hacia muchisimo tiempo que no escuchaba un disco tan bueno de principio a fin. Gracias. Y, ahora me gustaria preguntarte sobre tu gira, como será el concierto?Será un gran espectaculo o algo más intimo?No sé cuenta algo sobre ellos, vale?Tengo muchas ganas de verte en directo aunque tendré que esperar hasta Septiembre pues es cuando actuas en Madrid. Besos.

Object

831Object22/06/2002 04:09:49

¿Qué piensas de tus miles de fans que han comprado tu maravilloso disco y te quieren y te apoyan tanto? MªÁngeles (Almería), una de esas fans que te quiere muchísimo y que le encanta tu disco. ¡GUAPO! Eres un artista.

Object

832Object22/06/2002 04:10:10

¡Hola! Soy una chica de Granada, y me gustaría saber si vendrás aquí en tu gira. Recibe mi apoyo y todo mi cariño.Margarita.Granada

Object

833Object22/06/2002 04:10:15

Queria preguntar como se siente David despues de todo el exito que esta teniendo y que nos contara alguna anecdota del paso de sus fans en los conciertos. Gracias

Object

834Object22/06/2002 04:10:21

Hola David.¿Como te va todo? ¿Te ha cambiado mucho la vida?. Que sepas que para mi eres el mejor. No cambies nunca.Un Besazo.

Object

835Object22/06/2002 04:10:58

hola bustamante, me llamo tania y soy de zaragoza. ¿que tal llevas lo de ser tan famoso? ¿que opinas de tus fans?

Object

836Object22/06/2002 04:11:43

Hola Busta! he visto a todos tus compañeros y solo me faltas tu...me encanta tu disco y me gustaria saber cuando sera la firma d discos en barcelona!!Te quiero!!! eres el mejor!!!!Jessy!!

Object

837Object22/06/2002 04:12:44

hola busta, soy tania, una chica de zaragoza. ¿como puedo contactar contigo?

Object

838Object22/06/2002 04:12:51

¿Qué es lo que cambiarías de la nueva profesión que comienzas a disfrutar?Un beso muy grande de una madrileña-santanderina.Leyre.

Object

839Object22/06/2002 04:13:07

Bueno, antetodo te queria decir que tu disco es una pasada, pero bueno te escribo para hacerte una pregunta que hace tiempo me ronda por la cabeza: ¿ Cuala fue la última chica de la que te enamoraste?? Por favor se sincero, OK?? Un besazo wapeton. MMMMMMMMMMMUUUUUUUUUUUAAAAAAAAAAAACCCCCCCCCCCCCCCC

Object

840Object22/06/2002 04:14:03

Estoy seguriiiisima de que te espera una larga carrera musical,¿¿pero t gustaria dedicarte algun dia a television o cine??,TQM.BLANCA(andamia)

Object

841Object22/06/2002 04:14:10

David,¿se te han declarado muchas veces?de una fan de malaga que te quiere con locura¡¡¡

Object

842Object22/06/2002 04:14:48

HOLA BUSTAMANTE,¿CREES QUE TE MERECIAS TU EL 3º PUESTO MÁS QUE CHENOA? ADIOS MUCHA SUERTE A TODOS. ALBA

Object

843Object22/06/2002 04:15:20

¿¿¿qué es lo que comes para estar tan bueno y tener esa pedazo de voz que nos enamora a todas tus fans???te kiero david.BLANCA(andamia)

Object

844Object22/06/2002 04:16:00

¿Hay alguna canción que te guste especialmente de tu disco o que en cuanto la escuchaste supiste en ese mismo instante que tenías que incluirla en él? ginny-14, un beso de mi parte y de todo el foro de portalmix. ¡Te queremos,David!

Object

845Object22/06/2002 04:16:13

Si te dieran la oportunidad de elegir un cantante para realizar un dueto ¿a quién eligirías?.Un besazo,no cambies Leyre.

Object

846Object22/06/2002 04:16:53

hola busta, soy tania una chica de zaragoza. ¿que sentiste cuando subiste al escenario de zaragoza? lo digo porque fue el primer concierto. ¿tenias nervios?

Object

847Object22/06/2002 04:18:28

PIENSAS DEDICARTE SOLO A LA MUSICA?O MAS ADELANTE PUEDE K T TIRES POR EL CINE , SEGURO K TRIUNFAVAS,CAMPEON,EVA DE BENIDORM

Object

848Object22/06/2002 04:18:56

Hola David!! Quería saber cómo estas preparando la gira y si va a continuar después del verano. Un beso y ojalá que vengas para Granada. Te queremos! Inma.

Object

849Object22/06/2002 04:19:34

K OPINAS SOBRE EL FENOMENO FANATICO K TIENE LA GENTE NO SOLO ACIA A TI SINOS TAMBIEN ACIA TODOS TUS COMPAÑEROS DE O.T,EVA BENIDORM

Object

850Object22/06/2002 04:19:38

bustamante eres guapìsimo tengo todolas cosas tuyas hasta el disco la camisata y muchos posters y me gustaría mucho conocerte en persona. maria desde neda- la coruña...

Object

851Object22/06/2002 04:20:13

CUANTO CREES K DURARAS EL LAS MEJORES POSICIONES DE LAS LISTAS DE VENTAS?EVA BENIDORM

Object

852Object22/06/2002 04:20:14

¿¿qué va a hacer una vez que termines tu gira en españa y america??blanca(andamia)

Object

853Object22/06/2002 04:21:15

Hola David,en primer lugar gracias por lo que estas aportando a la música y suerte.Mi pregunta:¿Qué es lo que más te disgusta de la fama?Un beso.Maribel.carbel27

Object

854Object22/06/2002 04:21:44

Besos,dame muchos besos,dulces y traviesos. ¿Quién te gustaría que fuera la destinataria de esta "dulce" canción?. Saludos de una admiradora de tus cuerdas vocales,jejeje.Ley.

Object

855Object22/06/2002 04:22:49

HOLA WAPETON!!! COMO SIENTA ESTO DE SER FAMOSO Y QUE TODO EL MUNDO TE RECONOZCA POR LA CALLE? CUANDA VAS A HACER UNA FIRMA DE DISCOS POR BARCELONA? TENGO MUCHAS GANAS DE VERTE EN PERSONA... ME ENCANTA TU DISCO, ES EL MEJOR!! ESPERO QUE LA VIDA TE VALLA IGUALDE BIEN QUE HASTA AHORA. MARIA. BARCELONA

Object

856Object22/06/2002 04:23:18

He mirado la lista de los conciertos que vas a dar y he visto que no pasas por Vizcaya. Es una pena porque aqui tienes muchísimas fans que en su dia mandaron mensajes para salvarte y para que salieses ganador. ¿Porque no pasas? ¿Lo has decidido tu?

Object

857Object22/06/2002 04:23:44

¿¿¿¿qué opinan tus hermanos de todo lo que te esta pasando????son muy wapos,normal¡¡¡¡cn un hermano cmo tu,no m extraña,un beso TQM.blanca(andamia)

Object

858Object22/06/2002 04:24:55

David ¿no temes perder tu acento y esa forma de hablar tan característica de nuestra tierra al pasar tan poco tiempo en Cantabria con los tuyos? Un besuco enorme. ELENA (Cantabria)

Object

859Object22/06/2002 04:25:56

¡Hola David! Quería saber si el tu próximo disco vas a componer tú alguna canción. Eso espero porque eres el mejor. Muchos besos dulces y traviesos. Inma (Granada)

Object

860Object22/06/2002 04:26:00

bustamante, ¿haber llegado hasta aqui supone para ti haber realizado tu sueño?¿harás algún concierto más en La Rioja aparte del que ya tienes preparado? con cariño de Elisa(Logroño)

Object

861Object22/06/2002 04:27:06

¿Cuándo vendrás a jerez de la frontera a firmar tu nuevo disco? besos Paula

Object

862Object22/06/2002 04:27:21

Bustamante,¿es cierto que estas saliendo con Gisela? a nosotras nos gustaría muchisimo, haceis muy buena pareja. suerte con tu gira. te queremos

Object

863Object22/06/2002 04:27:50

¿HOLA guapisimo soy la chupachup t queria ¿? cuando vas ha firmar autógrafos en Mataro parc?

Object

864Object22/06/2002 04:28:00

¿¿¿qué significa el tatuaje que llevas en el brazo???TQm,no cambies nunca eres mi vida.BLANCA(andamia)

Object

865Object22/06/2002 04:28:23

Busta, ¿podrás venir alguna vez a cantar a Carmona(Sevilla)?

Object

866Object22/06/2002 04:29:00

hola. ya tengo entradas para ver tu concierto en pamplona el 4 de julio. ¿vas a firmar discos? en el caso de que no lo sepas haz que asi sea por favor.gracias

Object

867Object22/06/2002 04:29:06

¿¿¿por qué no vienes a sevilla de gira???aki se t kiere muxo,un beso,TQM.blanca(andamia)

Object

868Object22/06/2002 04:29:06

¡Hola David! Soy una valenciana que siente pasión por todos vosotros. Te imaginabas que ibas a llegar en tu vida a donde estas ahora?Para mi estais en un pedestal (me encantaria estar ahi,pero con vosotros) Besitos y mucha suerte. Marta.

Object

869Object22/06/2002 04:29:16

Te ha sido dificil llegar hasta donde has llegao? Bustamante eres el mejor!!!!

Object

870Object22/06/2002 04:29:51

DAVID CARIÑO COMO ACES PARA ESTAR ASI ???EQE NO VEAS SI ESTAS BUENO!!!!!!!APARTE DE Q ERES EL MEJOR!!!!Y TU CD ESTA INCREIBLE!!!!TE QUIERO BUSTA SIGE ASI!!!!!!Q SEGUIRAS TRIUNFANDO!!!A VER CUANDO VIENES A MALAGA,EN???VOY A IR A los 2 CONCIERTOS!!!!!!!!!! BESOS. MARINA BASTIAS. MALAGA.

Object

871Object22/06/2002 04:30:24

TIO BUENO!!!!!!!!

Object

872Object22/06/2002 04:31:17

David, podrías describirnos exactamente que sientes cuando estás encima del escenario y todo el público corea tus canciones? Muchas gracias, un beso y toda una vida de éxitos merecidísimos. Eres una maravilla de artista y de persona. Gemma.

Object

873Object22/06/2002 04:31:39

Hola cariño espero q me respondas ha esta respuesta cuando vas a firmar autógrafos en el mataroparc

Object

874Object22/06/2002 04:32:22

David,¿Estas contento de haber llegado hasta aqui?¿ligas más o menos ahora que eres famoso? Ánimo porque vas a llegar muy alto.Elisa (Logroño)

Object

875Object22/06/2002 04:32:23

¿Cuando vas a dar el concierto en santander?

Object

876Object22/06/2002 04:32:44

hombre, busta... ¡¡¡anda q no tnia yo ganas d hablar contigo!!!. total, empiezo ya... (los nervios m tan matando) oye, porque razon no vienes a sevilla??? me encantaria que te pasaras... aunque fuera a firmar cds... yo lo tengo y esta muy bien, la cancion que más me gusta es la que haces con alex que se llama: dos hombres y un destino. por cierto, en el poster sales estupendamente. fijo que te estoy aburriendo con estos estupidos comentarios. bueno... porqué no vienes a sevilla??? mira, respondeme, y si quieres...jeje... cuando me respondes me dices tu movil. jajajaja... hombre... que fijo que de tantas fans no me lo vas a dar expresamente a mi. bueno, chao tio bueno.

Object

877Object22/06/2002 04:32:45

Hola Busta! mi pregunta es la siguiente: ¿Qué es lo que más echas de menos de tu vida antes de entrar en la Academia?. Sigue así, no cambies por nada del mundo. Noelia (Madrid)

Object

878Object22/06/2002 04:34:04

¿¿qué es mas importante para ti ser picallo de honor en tu pueblo o ser ganador d OT e ir a eurovision??un beso TQM,blanca(andamia)

Object

879Object22/06/2002 04:34:45

hola busta! soy una chica de barcelona tengo 13 años i me llamo sandra! en el foro me llamo OT.The best keria decirte k te he apoyado desde el principio i te seguire apoyando wapoo!!! kuando vendras a firmar discos en barcelona? ya estoy anseosa ya k te he comprado un regalo entre mi mejor amiga ana i yo! espero k me contestes! eres el mejorr!!!! el busta el busta el busta es cojonudo como el busta no hay ninguno!!! muchos besos!!!

Object

880Object22/06/2002 04:35:52

¿seguro que podras venir al chat? ¿hablaras con muchas fans? yo soy una de tus fans.

Object

881Object22/06/2002 04:35:56

Hola Titin!! ¿cuando vas a volver a la tierruca? Se te echa de menos,alegras nuestros corazones con esa grandiosa voz que tienes. Cristina Alonso(Cantabria).(AUPA-BUSTA)

Object

882Object22/06/2002 04:36:09

David,tengo tu misma edad y te admiro porque has conseguido llegar a cumplir un sueño.Nos conocimos en un programa de tele,me cantaste Cantabria a capella antes de que empezara el directo.Tienes un corazón de oro y espero que nunca dejes que te cambien.Mi pregunta es:¿qué canción regalarías a tú público en los conciertos qué significara algo muy especial para tí? Besotes,Ley.

Object

883Object22/06/2002 04:36:43

Hola David: te escribe una admiradora desde Bolivia, quiero decirte que te quiero mucho y preguntarte cuando vas a venir por aqui ya que tienes muchas fans. te deseo lo mejor guapo de tu fans MAIRA....

Object

884Object22/06/2002 04:37:05

david¿te has planteado, que a raiz de tu popularidad, eres el reflejo de miles de jovenes,que podrían imitarte en cualquiera de tus actitudes?me encanta tu disco y porsupesto yá me lo he comprado.una admiradora. LIKEONE.

Object

885Object22/06/2002 04:37:28

Hola David, y enhorabuena por todo lo que has conseguido y, sobre todo, por lo que mucho que seguro lograrás. ¿Cuándo te veremos recogiendo el disco de diamante? Hay rumores de que ya has vendido muy por encima del millón de ejemplares...

Object

886Object22/06/2002 04:37:35

hola david q tal estas???? lo 1º q sepas q eres el mejor de mundo (mundial....jejeje) oye cual es la cancion preferida de tu disco?????? impresionantes las coreografias eeehh? espero q m contestes wapeton . un beso (dulces y traviesos) .paz_busta!

Object

887Object22/06/2002 04:37:39

¿¿cuando te cases volveras a vivir a sn vicente de la barquera??TQM,blanca(andamia)

Object

888Object22/06/2002 04:38:12

¿si me pongo al chat me responrdias? ¿eres muy famoso? ¿mas que los otros famosos?

Object

889Object22/06/2002 04:38:14

¿vas a ir a vivir a san vicente?

Object

890Object22/06/2002 04:38:43

¿¿te sigue preocupando tanto "la perdida de los tonos"??si no es asi,aki tienes una sevillana d 19 años que se ofrece,jajaja,TQM,un beso.blanca(andamia)

Object

891Object22/06/2002 04:40:04

¿tu primer disco tiene exito? ¿Y el cd dev los dedmas?

Object

892Object22/06/2002 04:40:27

¿¿seguiras yendo a las fiestas de tu pueblo??Yo te invito a la feria de sevilla,y espero k vengas,aunke sea dentro de muxos años,me da=,pero m gustaria estar cerca de ti,TQM.blanca(andamia)

Object

893Object22/06/2002 04:41:45

tus admiradoras tenemos ganas de escribirte ¿si te escribimos contestaras?

Object

894Object22/06/2002 04:41:50

¿tienes muchas fans? ¿igual que los otros 15 amigos tuyos que conociste a o.t.?

Object

895Object22/06/2002 04:41:54

se puede decir que ahora mismo eres feliz,lo tienes todo,¿¿pero hay algo k te falte realmente??TQM,blanca(andamia)

Object

896Object22/06/2002 04:42:30

¡¡Holaa!! me llamo Verónica, tengo 12 años y soy de Barcelona.¿¿Cuando vas a venir a Barcelona a la firma de discos?? Espero que siempre tengas el éxito que tienes y un saludo del foro!! adios un beso para ti y otro para tus padres y hermanos. Adios.

Object

897Object22/06/2002 04:42:37

Hola BUSTA te escribo desde BOLIVIA, quisiera saber si una de las chicas de OPERACION TRIUNFO te gusta ya que para mi das bonita pareja con NURIA FERGO. de tu admiradora MAIRA.

Object

898Object22/06/2002 04:43:53

El disco se va a internacionalizar?

Object

899Object22/06/2002 04:44:01

hola guapo,soy paisana tuya ,de santander,y me gustaria saber,¿¿ que ta ha parecido el atentado de eta en santander?? un gran,gran,beso pa ti solo q eres el mejor. te quiero .***maria***

Object

900Object22/06/2002 04:44:05

¿¿te gusta que tus fans llevemos los pañuelos rojos??me hizo muxa ilusion verte por la tele cn el,porke es un simbolo de k tu tb ns kieres y t akuerdas d nosotros,gcias¡¡¡t kiero,blanca(andamia)

Object

901Object22/06/2002 04:44:29

Hola David. Cual es la cancion de tu disco que te gusta mas? a mi me gustan todas....

Object

902Object22/06/2002 04:44:54

Hola David! Me llamo Miriam y soy de Canarias. Me pareces un gran artista, por el sentimiento que derrochas en el escenario y la voz tan bonita que tienes. Además, pareces buena persona y se ve que posees un gran corazón, corazón que entregas en cada actuación. Me gustaría saber qué opinas de las afirmaciones que hace mucha gente, diciendo que ustedes, los chicos de Operación Triunfo, son un producto de mercado, que están ahí por el marketing, publicidad que se ha ehcho y demás. Un beso y mucha suerte en tu carera musical y en tu vida, porque la mereces. Me encantaría poder conocerte algún día, a ver si puede ser posible cuando vengas a Canarias. Hasta siempre.

Object

903Object22/06/2002 04:45:20

Que cancion te gusta más del CD de Gisela???? - Andreu-Triunfo

Object

904Object22/06/2002 04:46:05

Hola David.En primer lugar, queria decirte, que eres mi favorito desde el principio, y luego ahi va la pregunta ¿te gustaria componer en tu prómimo disco?

Object

905Object22/06/2002 04:46:36

¿¿te gusta cmo t visten y como t peinan??o preferirias cambiar d look y vestir d otra manera??tu antes vestias asi tambien??TQm,blanca(andamia)

Object

906Object22/06/2002 04:47:20

hola David. que tal campeon? ¿que es para ti un "mundo ideal"?

Object

907Object22/06/2002 04:48:34

¿Cual fue tu primera impresión al salir al escenario del Palacio de Festivales y encontrarte con la gente de tu tierra?

Object

908Object22/06/2002 04:48:35

Como te sientes, ahora, que acaparas casi mas miradas que Rosa?

Object

909Object22/06/2002 04:50:00

david: desde MÉXICO te mandamos un saludo, hemos seguido tu carrera y esperamos hablar contigo este lunes. Fam. Fernández

Object

910Object22/06/2002 04:50:08

K piensas de tus fans y de tu foro que está loquito por ti xq sabes k no solo nos gusta tu cuerpo tu forma de ser y tu forma de actuar k si pero sobretodo tu prodigiosa voz ánimos de una bilbaína k te quiere mucho y k te admira. Ah! k tal te sientes con ese pedazo de disco k as sacao?

Object

911Object22/06/2002 04:50:42

¿Con que canción de tu disco te sientes más identificado? ¿A que edad te gustaría casarte?

Object

912Object22/06/2002 04:51:28

HOLA BUSTA! me digeron algo de que te ibas a vivir a madrid o barcelona, ¿es verdad? ojala vengas a barcelona!! :D

Object

913Object22/06/2002 04:52:30

hola Bustamante, felicidades por tu disco. ¿Cómo te sientes al ver que estas compitiendo en las listas de ventas con tus compañeros? ¿a que crees que es debido tanto exito? un beso, Idaira Las Palmas.

Object

914Object22/06/2002 04:52:31

¿¿¿sigues fumando???no crees que es perjudicial para tu pedazo de voz???un beso fuerte,beatriz(beatrizc16 en tu foro).

Object

915Object22/06/2002 04:52:50

¿Que piensas de la pirateria?¿Pensabas lo mismo antes de entrar en la academia? Rosa P.Santiago de Compostela

Object

916Object22/06/2002 04:56:30

el dia que tengas una relacion sentimental,lo diras???un beso,TQM,beatriz(sevilla)

Object

917Object22/06/2002 04:57:18

Te habla una fan de Eduador, Me pareces una persona con una personalidad bastante transparente, espero que nunca se te suban los humos de la fama, mi pregunta es ¿Hasta dónde piensas llegar en la vida y en el ámbito de la música?.

Object

918Object22/06/2002 04:59:37

Hola.Me llamo Vero y tengo 12 años. Antes te he enviado otra pregunta, pero te la repito: Cuando vas a venir a Barcelona a la firma de discos?? la direccion que sale en tu disco, los e-mails te llegan a ti?? mi direccion es : vero_barea@hotmail.com, un saludo del foro y recuerdos a tu familia. adios

Object

919Object22/06/2002 04:59:44

Titín, eras mi favorito desde el principio y lo sigues siendo. ¿Crees que ahora entre todos los compañeros de O.T. no va a existir la competencia por vuestros CDs?¿Cómo te imaginas dentro de 20 años? Un Beso que te lo mereces. Jenni (Las Palmas):)

Object

920Object22/06/2002 05:00:02

hola Titin! tengo una pregunta:¿Crees que gracias al apoyo de tus fans,tu disco se ha realizado con más empeño, cariño, y se transmiten tus miles de gracias a tus fans?A mi personalmente me encanta!! un besazo enorme: Marta Morán González

Object

921Object22/06/2002 05:00:03

¿Que piensas de la gente que dice que los de Operacion Triunfo son lo peor de la musica española? Rosa Pulleiro.

Object

922Object22/06/2002 05:01:24

SOY UNA NIÑA DE ONCE AÑOS PERO TE QUEDARIAS UN CON MIGO PARA CONPLACERME

Object

923Object22/06/2002 05:01:59

¿Quien es tu cantante favorito? Rosa Pulleiro

Object

924Object22/06/2002 05:02:56

¿Que sentistes al ir a eurovisión ?

Object

925Object22/06/2002 05:02:57

BUSTAMANTE KUANDO VENGAS A GRANOLLERS CREES Q TE GUSTARA?SI PORQUE SOMOS LOS MEJORES Y TE APOLLAMOS TODO LO Q PODEMOS ERES EL MEJOR.MONTSE GOMEZ TE QUIERO MUCHO

Object

926Object22/06/2002 05:04:26

hola wapeton. soy esther y voy a ir a verte al tivoli en malaga me gustaria saber si vas a ir a firmar discos al corte ingles o muchisimo mejro al prica los patios,anda intenta ir al prica los patios k asin te pòrde ir a verte porke mi tia trabaja alli un besazo guapeton

Object

927Object22/06/2002 05:04:45

¿LEES LAS CARTAS DE TUS ADMIRADORAS?

Object

928Object22/06/2002 05:05:35

¿Busta te habias planteado alguna vez que ibas a vivir algo tan grande como es llegar a cantante?Irene.Lora del Río(Sevilla).

Object

929Object22/06/2002 05:09:40

Estas con Gisela y tu amigo Naím con natalia si o no?

Object

930Object22/06/2002 05:09:51

¿¿¿dejarias tu trabajo por amor como han hexo muxos cantantes en el pasado??TQM,bea y blanca d sevilla.

Object

931Object22/06/2002 05:10:13

HOLA DAVID,PRIMERO TE QUERIA FELICITAR POR TU GRAN EXITO Y ESFUERZO QUE HABRAS ECHO PARA LLEGAR HASTA DONDE HAS LLEGADO.SOY UNA CHICA QUE VIVE EN 1 PUEBLO DE SALAMANCA(CIUDAD RODRIGO).ME GUSTA MUCHO TU MUSICA Y ME PARECES UN CHICO MUY MAJO .SIGUE ASI DE SIMPATICO.BESITOS DE UNA SALMANTINA.NURIA M.TELF:605115051.CONTESTAM.

Object

932Object22/06/2002 05:11:12

porque no vienes a Cuenca a cantar ?

Object

933Object22/06/2002 05:13:37

BUSTA SOY DE EL EJIDO (ALMERIA) EL 1 DE JULIO QUE ES TU CONCIERTO AQUÍ, ESATRÉ ESPERANDOTE TODO EL DIA Y CUANDO EMPIEZE EL CONCIERTO Y VEAS UNA PEAZO DE PANCARTA QUE PONGA: "LAS ALMERIENSES TAMBIEN TE QUEREMOS VIVA BUSTA!" Y MUCHAS TOTOS TUYAS SOLO QUIERO QUE TE ACUEREDES DE MI, DE ISA VAZQUEZ QUE LLEVARA TU PAÑUELO DEL CLUB DE FANS OFICIAL QUE COMO TANTAS OTRAS FANS TUYA TE ADORAMOS Y QUE SEPAS QUE AQUI ESTA TU FAN Nº1, EN EL EJIDO-ALMERIA- Y MI PREGUNTA ES LA SIGUIENTE-¿TE ACORDARAS?-

Object

934Object22/06/2002 05:17:51

HOLA DAVID, SOY UNA GRAN SEGUIDORA TUYA D 12 AÑOS Y ESTOY LOQUITA POR TUS HUESOS. ESTOY INTRIGADA POR SABER CUAL ES TU CANCIÓN PREFERIDA DE TU DISCO. MUCHAS GRACIAS, Y PORFAVOR SI PUEDES PONTE EN CONTACACTO CONMIGO EN Periquita01@hotmail.com NUNCA CAMBIES, ERES EL MEJOR Y NO EL BISBAL COMO DICE MUCHA GENTE. GUAPOOOOOOOOO!!!!11

Object

935Object22/06/2002 05:18:01

HOLA SOY NURIA LA CHICA DE ANTES,ESPERO QUE NO T PIENSES QUE SOY DE ESAS CHICAS CHILLONAS QUE PERSIGUEN COMO LOCAS A SUS IDOLOS.SE ME OLVIDABA PREGUNTARTE UNA COSILLA:COMO SE TE OCURRIO METERTE EN ESTE MUNDO DE LA MUSICA SINEDO UN TERRENO PROFESIONAL TAN DURO Y DIFICIL? BUENO ME DESPIDO.UN BESOTE Y ANIMO BUSTA.MANDAME TU RESPUESTA AL MOVIL SI QUIERES.CHAO

Object

936Object22/06/2002 05:18:17

Crees que en algun momento la amistad q os une a los concursantes de Operación Triunfo se rompera por la gran rivalidad que existe. JUDIT

Object

937Object22/06/2002 05:18:48

hola busta majo lo primero decirte q tu disco es el mejor del momento y me atrevo a decir q el mejor de todos los tiempos dime de q conoces el NYX y el DJ MONTXO te lo oi decir los primeros dias en la academia y me interesa saber de q lo conoces gracias

Object

938Object22/06/2002 05:20:26

¿Qué tal en tu gira de operación triunfo? Te aconsejo que te cases con Gisela es muy guapa. Ánimo tío Bueno. Natalia San Fernando

Object

939Object22/06/2002 05:21:26

¿Cuantos hermnos son y que lugar ocupas? y de donde son tus padres

Object

940Object22/06/2002 05:21:55

Tenés novia???

Object

941Object22/06/2002 05:23:18

Hola David! Antes que nada, Felicitarte por el excelente disco que nos has regalado, no me canso de escucharlo. Te escribo desdela República Dominicana, y me gustaría saber si tienes pautado venir aqui como parte de tu gira promocional por latinoamerica, y mas o menos para cuando seria. Muchos besos desde el Caribe! Franchesca

Object

942Object22/06/2002 05:23:35

Primero quiero saludarte y desearte lo mejor,mi hija y yo te seguimos con entusiasmo ¿Que te resulta mas dificil luchar contra el miedo escenico o luchar conta tus emociones para que no te desborde cuando actuas en un concierto o una gala como la ultima,por ejemplo? Tus fans somos como tu flia. no te reprimas te queremos por ser como eres, autentico. Un besazo de Badalona,Barcelona.

Object

943Object22/06/2002 05:25:53

BUSTA ¿CREES REALMENTE AL VERTE CON OTROS ARTUSTAS QUE ESTARAS EN EL MUNDO DE LA MUSICA DURANTE MUCHO TIEMPO O COMO DOJISTES CREES QUE ESTO ES UN BOOM? LO DOGO POR QUE MUCHAS FANS ES POR EL FISICO Y POR QUE CREO QUE OPERACION TRIUNFO HA SIDO ALGO UN POCO RARO, BUENO Y FUERTE (CONFIESO QUE A MI ME ENCANTA) ULISES, ALICNATE.

Object

944Object22/06/2002 05:28:06

hola David, tellamas como yo y todo, mi pregunta es la siguiente: ¿ que sentistes cuando Carlos Lozano te dijo que estabas entre los ganadores de Operacion Triunfo 2002? Hasta luego

Object

945Object22/06/2002 05:28:37

Hola Titin!!¿Crees que gracias al apoyo de tus fans, tu disco lo has realizado con más esfuerzo, sentimiento, cariño y con ganas de dejar una huella que de gracias a todo el mundo? un besazo enorme: Marta Morán

Object

946Object22/06/2002 05:28:41

Primero queria saludarte y darte todo mi cariño,despues queria preguntarte:¿sabes lo que te queremos tus fans?,si solo lo imaginas has de saber que nuestro amor es infinito.Eres el hijo soñado,el novio deseado ,el amigo mas entrañable que quiero tener y lo mas importante sin haber hablado contigo personalmente , te admiro como un gran artista que eres y mejor ser humano,un besazo ,te queremos mucho en tu ciudad adoptiva,Barcelona

Object

947Object22/06/2002 05:32:30

David te saludamos mi hija y yo,te seguimos fielmente y compraremos tu musica por que eres un artistazo,ahora queremos saber¿eres feliz?,pero feliz como ser humano,como artista suponemos que si,pero te sientes feliz cada dia cuando te levantas y ves todo el mundo que te rodea,el mundo de la farandula a mi me parece muy frio y tu eres muy calido,un beso de dos Barcelonesas

Object

948Object22/06/2002 05:33:01

Hola Bustamante, soy una santanderina de 14 años que te admira mucho y que te sigue desde el principio del programa. Creo, sin duda, que eres el mejor artista que ha pasado por la academia y que te tienes muy merecido tu exito, por ello te felicito por tu gran disco, que cada vez que le escucho me gusta más. Por ultimo, quiero recordarte que cuentas con el apoyo de todas tus fans y espero poder verte en los conciertos que des aqui, en tu tierra, este verano. Besos, Alba te deseo suerte aunque no la necesitas, ah! se me olvidaba a ver cuando vienes a firmar discos a Santander!!!

Object

949Object22/06/2002 05:36:27

Hola David, me llamo Alba tengo 14 años y soy de Santander; desde siempre he pensado que eres el mejor, no solo porque seas un gran artista y porque estes muy bueno sino por el gran corazon que tienes que casi no te cabe en el pecho. Me gustaria felicitarte por tu exito bien merecido y desearte que tengas suerte para que cumplas tu sueño, aunque no la necesitas. Por cierto a ver cuando vienes a firmar discos a Santander, ya nos veremos este verano en los conciertos que des en tu tierra!! Estare en todos!!!! Besos, Alba una santanderina que te admira mucho

Object

950Object22/06/2002 05:38:10

Hola Busta estas son mis dos preguntas:¿como te has sentido al vender tantos cds y al tener tanto exito con tus fans y en las listas de ventas?¿te han dado ya el disco de diamante?Te mereces todo de este mundo.David,gracias por ser como eres.Un besazo muy fuerte.Guapo!!!!.Maria.

Object

951Object22/06/2002 05:38:30

Hola Busta:soy tu fan Nº1,decirte que tu disco es el mejor,y que todas las canciones son muy bonitas.Te voy a preguntar si,¿sabes si se haran galas o conciertos con los compañeros en los que se tiene un duo en el disco?,como es el caso de el disco de Gisela y el tuyo con Alex.Nada mas,solo decirte que eres el mejor y que Bustamante disco de diamante.Te kiero.Ana Cantabria(Santander).Muchos besos.

Object

952Object22/06/2002 05:39:49

En tu gira en solitario, cantarás también las canciones que interpretaste en Operación Triunfo? Y otra pregunta, ¿como es que tu gira no pasa por el Pais Vasco, estando tan cerca de tu tierra natal?

Object

953Object22/06/2002 05:40:32

Hola Bustamante eres maravilloso, soy una fans tuya que te ha seguido desde el principio aquí en Japón, me gustaría preguntarte si piensas lanzarte internacionalmente. Un beso Maria Elena

Object

954Object22/06/2002 05:41:00

que canción te gustaría que fuera tu próximo single? MªTeresa

Object

955Object22/06/2002 05:41:03

Hola desde Ecuador, mi pregunta es: todos tenemos un libro que escribimos diariamente en el ponemos todas las experiencias vividas y tarde o temprano la presentaremos en el juicio final,Considerando todo lo que has vivido que titulo le pondrias? y porque? Un beso. Mara

Object

956Object22/06/2002 05:42:10

como te sientes al ver tu sueño echo realidad? MªTeresa

Object

957Object22/06/2002 05:43:15

HOLA BUSTA!!!! ANTES DE TODO ME GUSTARIA FELICITARTE X TU CD KE ES STUPENDO. BUENO HAY VA MI PREGUNTA: ¿¿¿¿¿ X KE NO VIENES A EXTREMADURA A DAR UN CONCIERTO????? LA MAYORIA DE TUS COMPAÑEROS VAN A VENIR, X FAVOR HAZ UN HUECO EN TU AGENTA Y NOS HACES UNA VISITA KE LOS EXTREMEÑOS TAMBIEN EXISTIMOS. T ESPERO. ADIOS WAPETON

Object

958Object22/06/2002 05:43:51

david:¿dicen que el sueño de cada día esconde rosas llenas de espinas? ¿Tú también las escondes? ¿Vas a hacer promoción fuera de España? Espero que ahora te vayajn muy bien las cosas. Además que sepas que no puedo ir el día 29 a tu concierto porque es mi cumpleaños y estoy triste. Me llamo Reyes y soy una fan tuya de Madrid

Object

959Object22/06/2002 05:46:44

david,enhorabuena por tu triunfo.me gustaria saber si todo tu cd te gusta?o cantas alguna canción con la que no te sientes identificado?que planes tienes despues de los conciertos de verano?espero verte en santander.disfruta y suerte para el futuro.laura

Object

960Object22/06/2002 05:48:05

Hola David, recibe un gran saludo desde el otro lado del atlántico, especificamente en Sur America,mi pregunta es: Tus compañeros y tu son considerados estrellas e idolos a los cuales la gente sigue,aprecia y admira , estarias dispuesto a realizar campañas publicitarias en contra del racismo contra la gente inmigrante y que opinas al respecto?

Object

961Object22/06/2002 05:48:41

David bustamante tienes novia, soy una fan tuya y teve el 9 de septiembre en directo porque me gustas muchas, yo tampoco tengo novio y tengo tu disco y beso de una fan que te kiere y me llamo natalia tengo 19 soy de alcorisa es un pueblo de teruel

Object

962Object22/06/2002 05:50:54

¿Por qué no vienes de gira a San Sebastian?

Object

963Object22/06/2002 05:51:20

Busta: si al final las cosas te salen mal y no llegas a más ¿Qué te gustaría hacer? Espero que esto no sea así porque para mí sería algo malo. Te seguiré hasta que mi corazón deje de latir

Object

964Object22/06/2002 05:54:37

HOLA GUAPETON! SOY MARIBEL DE BARCELONA Y ME GUSTARÍA SABER SI VAS A CUMPLIR MI SUEÑO DE VENIR DE FIRMA DE DISCOS EN BARCRELONA, MUCHAS GRACIAS, Y SI ES AFIRMATIVA LA RESPUESTA ¿CUANDO? PUES MUCHAS GRACIAS Y HA VER SI VUELVES A SER EL NÚMERO UNO DE LAS LITAS DE VENTAS ESPAÑOLAS POR QUE TE LO MERECES, UN BESAZO CORAZÓN!

Object

965Object22/06/2002 05:55:56

hola! a mi me hace mucha ilusion que empiece de nuevo operacion triunfo, pero, ¿no te da un poco de miedo ir "perdiendo" fama al salir más cantantes?mucha suerte, aunque no necesitas mucha mas.agur!

Object

966Object22/06/2002 06:04:30

¿cuando vienes a madrid a firmar discos?

Object

967Object22/06/2002 06:06:38

¿Por que no vienes algun dia a Piedrafita do Cebreiro? Xfa, pásate x akí. MUCHOS BESOS DE 2 BUSTAFANS DE PIEDRAFITA QUE TE VAMOS A IR A VER A PONFERRADA. ¡¡¡¡SUERTE PRECIOSO!!!!!!

Object

968Object22/06/2002 06:07:38

Donde se ve david bustamante en 10 años?

Object

969Object22/06/2002 06:07:49

Busta eres el mejor, de verdad. No podemos explicar lo que transmites cada vez que cantas.ES TU MAGIA.¿qué sientes cuando ves a tanta gente en un concierto gritando o llorando por ti?¿Vas a venir a Murcia a firmar algún día. Gracias por ser tú. SILVIA MURCIA

Object

970Object22/06/2002 06:08:10

Que le dirias a fans,como yo,que estan locas por conocerte y tocarte?1beso wapisimo.TE KIERO.

Object

971Object22/06/2002 06:08:32

Hola guapo, ¿como es tu chica ideal?, ¿tendrias una relación a distancia? Besos -LoVeBuSTa

Object

972Object22/06/2002 06:08:51

te has puesto a pensar cuantos paises conocen a david bustamante despues de operacion triunfo?

Object

973Object22/06/2002 06:10:46

Hola David, ¿que nombre de mujer te gusta? Te quiero!! -Thammy

Object

974Object22/06/2002 06:11:24

QUE ES LO MEJOR QUE TE HA SUCEDIDO HASTA HOY¿? UNA FAN NUMERO UNO Q TE QUIERE Y TE MANDA SALUDOS.MAY

Object

975Object22/06/2002 06:12:24

Hola Busta, soy una chica de 14 años.Tanto mis amigas/os como a mi nos encanta tu voz.Pero yo te queria preguntar que...... ¿COMO PUEDES SER TAN GUAPO Y ESTAR TAN BUENO?. No cambies y sigue asi. Te queremos mucho,todo el mundo te aprecia por tu voz, por tu fisico,pero sobre todo por lo buena persona que eres. VIVAN LOS ALBAÑILES DE CANTABRIA!!! TE QUEREMOS MUCHO!!!.Burgos.

Object

976Object22/06/2002 06:13:05

¿Qué es lo más difícil que te ha resultado en tu camino hacia la fama?

Object

977Object22/06/2002 06:13:38

me gustaria saber cuando bendra a la republica dominicana,ya que aqui gusta muchisimo.

Object

978Object22/06/2002 06:13:42

¿Vas a dar algún concierto en Zaragoza pronto?

Object

979Object22/06/2002 06:13:53

Cuando vas a venir a presentar tu disco en Valencia, si vas ha hacer un concierto por aquí.

Object

980Object22/06/2002 06:14:30

BUSTAMANTE COMO TE SIENTES DESPUES DE HABER VENDIDO TANTOS DISCOS?piensas que eres un ribal de bisbal??

Object

981Object22/06/2002 06:16:24

¿xq estas tan bueno? ¿y cantas tan bien ?

Object

982Object22/06/2002 06:17:09

HOla David!¿has pensado en incluir una balada en Italiano en tu proximo cd?ya se que ahora mismo estas centrado en el primero pero te aseguro que a mas de una persona(como yo)nos encantaria. Un besazo!y nunca cambies(aunque sea quizas la frase que mas te han repetido en este tiempo,por favor que esto no reduzca su valor) Otro beso desde Marbella.Amalia

Object

983Object22/06/2002 06:17:18

TE GUSTARIA IR CRUZAR EL CHARCO Y PRESENTAR ALLI EL DISCO Y QUE SE HA UN GRAN EXITO COMO LO ESTA SIENDO AQUI EN ESPAÑA O INCLUSO MEJOR,Q OPINAS MAY ARRIBA BUSTA ERES EL MEJOR

Object

984Object22/06/2002 06:18:18

david,siendo tan pronta tu fama,con las miles de fans que tienes y tu exito tan espectacular con tu maravilloso disco:¿tienes miedo que toda esta burbuja en la que estás pueda explotar en cuaquier momento?ani-(atarfe)GRANADA.

Object

985Object22/06/2002 06:19:33

QUE FUE LO MAS SORPRENDENTE QUE TE PASO EN EL CONCIERTO ESPECIAL BUSTAMANTE EL MARTES Y SIN OLVIDARNOS QUE ESTABAS EN TU TIERRA NATAL MARIA G. BESOS Y MUCHA SUERTE

Object

986Object22/06/2002 06:22:28

ME GUSTARIA SABER CUANDO VAS A FIRMAR DISCOS A MADRID.ME ENCANTARIA CONOCERTE EN PERSONA ERES LO MEJOR QUE HA OCURRIDO EN ESTOS TIEMPOS ANIMO Y QUE NO CAMBIES NUNCA TU MANERA DE SER.POSDATA: DA RECUERDOS A LOS DE CUENCA QUE PARECE QUE ESTAMOS MARGINADOS NO VENIS NINGUNO POR AQUI Y ME DA MUCHA PENA BESOS MARIA

Object

987Object22/06/2002 06:23:10

¿sabes que eres motivo de celos en los maridos y novios de media España?que les dirias?¿que aprendan a cantar baladas?jaja eres unico y el mejor!has hecho que madres vuelvan a ilusionarse,jovenes crean en luchar por lo suyo y abuelos sientan orgullo de la juventud que hereda nuestro pais. un besote desde MArbella.Amalia

Object

988Object22/06/2002 06:23:12

Se ve a legua que entre tú y Gisela hay mucha química. ¿Te gustaría que ella fueraalgo mas que amiga tuya? ¿Te gustaría que en tu próximo disco que espero que sea todo un exito o mas que este participara ella en tu disco? Sois los mejores. Besitos Fany

Object

989Object22/06/2002 06:25:18

David, eres el mejor cantante que ha pisado la tierra, pero ¿por qué tu gira no pasa por Barcelona? Se puede ampliar la gira o ya no tenemos posibilidad de verte con Vero en concierto este verano en Barcelona?

Object

990Object22/06/2002 06:25:27

¿Cuál es la canción de tu vida? Por cierto no cambies

Object

991Object22/06/2002 06:26:15

bustamante sabemos que tienes un gira preparada este verano con veronica.cuando empezara esta gira?¿pasareis por mallorca?¿k dia? una fan mallorquina.muchos besos!!!

Object

992Object22/06/2002 06:26:38

¿que te gustaria tener en tu gira?algo que siempre hayas soñado....no se por ejemplo dos bailarinas de muerte....fuegos artificiales....algun cantante invitado...no se... Muchos besos,y suerte en tu gira.Estamos deseando que disfrutes sobre el escenario,para que nos hagas disfrutar. No cambies nunca para qeu podamos seguir diciendo con la cabeza bien alta,que somos fieles seguidores tuyo,de el artista mas autentico. Amalia,Marbella

Object

993Object22/06/2002 06:26:50

Hola David! Me gustaría decirte que tu disco es sensacional. Me podrías adelantar qué singles siguen a Además de tí? supongo que No soy un superman no puede faltar... Muchas gracias. Javi

Object

994Object22/06/2002 06:27:29

vas a venir a Ronda(Malaga) en la feria de Pedro Romero en el mes de septiembre a cantar? o si kieres te pasas por alli a dar una vuelta

Object

995Object22/06/2002 06:28:02

bustamante sabemos que tienes una gira preparada con veronica.cuando empieza esta gira??? pasareis por mallorca? que dia?? una fan mallorquina, raquel.muchos besos!!

Object

996Object22/06/2002 06:29:24

VA A VENIR ALGUN DIA A VALLADOLID D. BUSTAMANTE

Object

997Object22/06/2002 06:30:30

Que es lo que mas te a gustado de grabar este disco?

Object

998Object22/06/2002 06:31:13

busta,sabemos k tienes una gira con vero.cuando empieza??pasareis por mallorca?k dia?una fan mallorquina,raquel.muchos besos!!

Object

999Object22/06/2002 06:31:58

cuando vienes a firmar autografos a murcia? noelia de murcia

Object

1000Object22/06/2002 06:32:11

hola! ahora estas en el mejor momento de tu vida, si esto se acabara que harias? mucha suerte y esperemos que no te pase nada de esto.TQM tu foro

Object

1001Object22/06/2002 06:33:46

¿algun dia empezaras a escribir tus propias canciones o eso lo dejas en manos de profesionales? seguro que si te pones lo consigues.Muuuuuchos beitos desde alicante.

Object

1002Object22/06/2002 06:33:48

hola guapeton tendremos la suerte de verte en mula como dice la gente? de tu fan numero1, jessica de murcia

Object

1003Object22/06/2002 06:34:28

Buenos dias, y felicidades por tu disco. Soy una fan tuya que vive en Francia, Orléans, y te quiero preguntar si vendras por aqui alguna vez a cantar y presentar tu disco! suerte precioso!

Object

1004Object22/06/2002 06:35:39

Hola soy una gran fan tuya de Francia, y me gustaria saber si te podrias enamorar de una fan, pero que no sea una histerica!! Gracias y mucha suerte guapeton!

Object

1005Object22/06/2002 06:35:54

hola David, quería preguntarte ¿ piensas visitar américa? si es si, ¿ cuando? aqui te queremos mucho, ya estamos formando tus clubs de fans oficiales y esperamos que nos visites pronto!! TE QUIERO WAPO!! eres el mejor!! Un bezaso muy grande desde Venezuela... Vanessa

Object

1006Object22/06/2002 06:35:56

¿tienes ya el disco de diamante? noelia de murcia

Object

1007Object22/06/2002 06:37:07

Muy buenas y felicidades por tu disco! Es verdad que ya tienes novia, es Gisela? gracias por contestar! Besos compañero y suerte!

Object

1008Object22/06/2002 06:37:42

Sabemos mucho de lo que has estado haciendo dentro de la Academia,algo de tu pasado,pero...¿qué está rondándole en estos momentos por la cabeza al chaval de 20 años que una vez se presentó a unos castings de televisión?Muchos besos y tira "pá lante" con el peazo de chorro de voz q tienes.Besucos.Ley.

Object

1009Object22/06/2002 06:38:17

Hola!! soy la fan nº de bustamante,para mi es el mejor, lo admiro mucho no solo por como canta sino por su manera de ser,me encanta!.Le queria preguntar que porque no hace ningun concierto en extremadura,creo que él no decide eso pero es que me llevaria una gran alegria si viniera aqui y no solo a mi sino a mucha gente, sin mas solo decirte que sigas igual que siempre que eres lo mejor.Un Besazo.MARTA (Badajoz)

Object

1010Object22/06/2002 06:38:27

BUSTA eres uno de los que mas has cambiado en la academia. Tienes un estilo que es el que a mi me gusta, asi que buena suerte. Y me gustaría preguntarte si david bisbal a hablado de mi pueblo CARTAYA alli en la academia alguna vez porque bisbal a disfrutado mucho aqui con la orquesta expresiones. Muchas gracias y buena suerte

Object

1011Object22/06/2002 06:38:29

Hola David, ¿ crees que alguna vez los medios de comunicacion han sido injustos contigo? ¡ piensas visitar america? mira que aqui te queremos mucho, ya tienes clubs de fans formandose, esperamos que nos visites pronto!! TE QUIERO WAPO!! eres el mejor... un bezaso muy grande desde Venezuela... Vanessa

Object

1012Object22/06/2002 06:38:54

Buenos dias! Es verdad que fuiste un adicto al la cocaina? no lo digo con mala intencion! Yo no lo creo por eso te doy la oportunidad de demostrar a los mentirosos que tu eres un chico estupendo y sano! Suerte y muchos besos!

Object

1013Object22/06/2002 06:40:28

Hola Guapíiiisimo!Que tal?Espero que de vez en cuando te pases por el foro y leas todos los mensajes que escribimos.No te quiero hacer ninguna pregunta en especial ya que te habran hecho todas las del mundo, ni tampoco te voy a pedir tu movil ya que ni puedes ni lo debes dar.(en una visita que hice a San Vicente con el colegio vimos a tu prima y nos lo dio sabes?pero el de casa creo)Solo te voy a pedir que guardes mi direccion de correo electrónico. berberecha@arrakis.es un beso, y a por el sugundo disco de diamante.

Object

1014Object22/06/2002 06:40:53

Hola David. Puedes decirnos que ventajas e inconvenientes encuentras ante el "revuelo" que se ha organizado con el concurso? Suerte. Carol

Object

1015Object22/06/2002 06:41:42

Hola David. Como haces para tener una vida mas o menos privada? o ahora es imposible?. Suerte. Carol

Object

1016Object22/06/2002 06:41:47

QUE OPINAS DE LA GENTE ECUATORIANA QUE VIAJA A TU PAIZ

Object

1017Object22/06/2002 06:43:12

hola David!! primero dejame decirte que eres un niño muy lindo y que me encanta tu ternura!! , mi pregunta es : Despues de tu gran exito y popularidad alcanzada gracias a tu hermosa voz y a Operación Triunfo ¿piensas realizar una gira por Latinoamerica?? Un besote! Sol Quito - Ecuador.

Object

1018Object22/06/2002 06:43:57

Bustamante ¿porque estas tan bueno?

Object

1019Object22/06/2002 06:45:04

Hola David, has triunfado mucho con tu disco: ¿crees que la gente hemos respondido bien? Gracias, felicidades por todo, y ¡¡a por el siguiente!! Besos, Carmen

Object

1020Object22/06/2002 06:45:11

Bustamante por simple curiosidad ¿te llevas bien con Verónica? ¿estas contento de que la gira te haiga tocado con ella?

Object

1021Object22/06/2002 06:45:32

ya se que ha pasado tiempo, pero ¿que es lo que mas ta ha sorprendido de eurovision? compañero...eres el mejor! patri

Object

1022Object22/06/2002 06:45:44

como te sientes con tu nuevo disco. y con gisela

Object

1023Object22/06/2002 06:46:51

Hola Busta, Despues de esta experiencia dentro de la academia y despues de ver lo que ha supuesto en el mundo de la musica, ¿estas satisfecho del trabajo hecho durante estos meses? Vera (barcelona)

Object

1024Object22/06/2002 06:48:52

TE GUSTARIA CONOCER UNA CHICA ECUATORIANA

Object

1025Object22/06/2002 06:49:28

¿No crees que en tu disco ha faltado una canción que fuera mas,de las llamadas de verano o más discotequera para que pudiera estar arriba de la lista?

Object

1026Object22/06/2002 06:50:33

me gustaria saber si vas a venir al final a madrid capital de gira,espero qsi,sino me muero.eres el mejor,TE QUIERO,cristina de madrid muxos besos

Object

1027Object22/06/2002 06:51:06

con lo bien que bailas por que no habeis escogido una canción marchosa como single?

Object

1028Object22/06/2002 06:51:23

HAY MUCHOS CANTANTES MUY BUENOS PERO SON MENOS LOS Q ABARCAN LA CREATIVIDAD,LOS COMPOSITORES,LOS ARTISTAS..TE VES COMO COMPOSITOR DE TUS TEMAS?QUE DICES DE UNA COLABORACION CON MARIAH CAREY?IRE A TU CONCIERTO EN VALENCIA

Object

1029Object22/06/2002 06:54:34

Que fué lo primero que se te pasó por la cabeza cuando te propusieron hacerte fotos desnudo?

Object

1030Object22/06/2002 06:54:46

hola bustamante! soy una extremeña muy fan de tu musica y me encantaria saber porque en tu gira de verano no ofreces ningun concierto en mi comunidad,un beso jana

Object

1031Object22/06/2002 06:55:59

¿PODRIAS CHATEAR CON TUS FANS MAS AMENUDO?

Object

1032Object22/06/2002 06:56:48

Quiero que sepas que en Israel hay un grupo de personas que te seguimos y admiramos. Eres muy bueno y si sigues estudiando y preparandote estamos seguros que seras el mejor. Lo haras?

Object

1033Object22/06/2002 06:58:56

¿Me podrias mandar un mensaje al 630762400

Object

1034Object22/06/2002 06:59:51

Hola David, esta es la pregunta ¿Que crees que has aprendido en este tiempo? y ¿Que te hemos aportado a nivel personal tus fans? Muchas gracias por ser así,tus sueños son los nuestros .Te quiere Nuria(Amandita)

Object

1035Object22/06/2002 06:59:57

Que es lo que sientes cuando en la entrada de los conciertos ves a las fans que acampan y pasan allí toda la noche,y no comen,ni duermen solo para veros?

Object

1036Object22/06/2002 07:01:03

Hola David!!! Soy una estudiante de 3º de Periodismo que está muy interesada en entrevistarte por cuestión de mi carrera, y me dicen que sólo se conceden estrevistas a los medios de comunicación. Tú que has salido del andamio y sabes que en la mayoría de las ocasiones sin ayuda no se logra nada, ¿Qué piensas de esta actitud? E.M.M.J

Object

1037Object22/06/2002 07:01:08

busta:¿piensas promocionar luego tu album en sudamérica?. yo soy chilena y me encantaría verte por acá. besos y felicitaciones

Object

1038Object22/06/2002 07:01:19

Tus fans te mandan muchas cartas?Y que te escriben?

Object

1039Object22/06/2002 07:01:51

Es verdad q este verano,en agosto,vas a hacer un concierto con Gisela en Valladolid,concretamente en Medina del Campo? Se q tu gira es con Vero pero es q lo he oido por ahí y me gustaría saberlo.Besos wapeton,para mi eres el número uno en todo.

Object

1040Object22/06/2002 07:02:09

Hola David. Soy una gran admiradora tuya. 1º decirte q tu disco me encanta (aunque ya t lo habran dicho muchas veces) Y 2º quería perguntarte una cosa: He visto las fechas de tu gira y me ha sorprendido ver q no tienes ninguna fecha en el Pais Vasco, ¿por qué?

Object

1041Object22/06/2002 07:03:19

Hola David. ¿ en tu proximo disco escribiras alguna canción?

Object

1042Object22/06/2002 07:04:34

Denro de la academia se te veia miy unido a Gisela, incluso tu compañero Alex dijo en algun momento que estabas enamorado de ella.¿Hay algo entre vosotros dos?

Object

1043Object22/06/2002 07:05:20

Hola WUAPISIMO!! me refiero como no a Bustamante, ante todo keria felicitarte por ser como eres, kiero que sepas que eres mi modelo a sseguir como persona, tener la personalidad que tu tienes es un regalo maravilloso, asi que disfruta de ello, ¡¡ FELICIDADES!!. mi pregunta para tí es: ¿porque no vienes a Melilla en tu gira?,me gustaria muchisimo que vinieras ya que eres mi idolo. Bueno nada más solo felicitarte por tu pedazo de cd, es preciosos, y te quiero decir una cosa, nunca en mi vida e llorado tanto, como lloro cuando escucho tu disco, y sobre todo cuando te veo cantarlas. ERES EL MEJOR. ¡¡ te quiero bustamante!! Bea de Melilla, 17 años.

Object

1044Object22/06/2002 07:05:25

PRISCILA LINO CUALES SERAN LOS PAISE QUE VISITARAS EN TU GIRA

Object

1045Object22/06/2002 07:06:16

¡¡ Hola Busta !!Soy una gran admiradora tuya malageña pepi ahora una preguntas, ¿con cual cancion de tu disco te sientes mas identificado? y ¿algunas de esas canciones seran tu nuevo single? un beso mu grande pà ti, pepi ;-)

Object

1046Object22/06/2002 07:06:43

Busta, soy un gran fan tuyo y.... ¿como te sentiras cuando recibas el disco de diamante? Lo digo porque estoy seguro que llegaras a conseguir-lo.Eres el mejor. RAFA CHICA,CALONGE(GERONA)

Object

1047Object22/06/2002 07:06:54

BUSTY! YA QUE HAS LOGRADO TU SUEÑO?AHORA TIENES ALGÚN OTRO SUEÑO!,EL MÍO ES CONOCERTE A TI .GRACIAS POR TU CD,ES UN REGALO. Mª DEL ESPINO DE SEVILLA.

Object

1048Object22/06/2002 07:07:53

hola rey!! ¿tu concierto de san vicente la barquera cuanto va a durar?¿Vas a cantar canciones que cantastes en ot?un besazo de tu niña madrileña sara muaksss VIVA MI NIÑO!!!

Object

1049Object22/06/2002 07:07:56

hola david!vas a actuar en madrid capital al final?eso espero pk sino me muero,te kiero muxisimo cristina(bustigirl18)madrid

Object

1050Object22/06/2002 07:08:30

hola bustamante,soy una xica de un pueblo muy chico,m gusta mucho cantar,t perdistes alguna vez la esperanza,al ver q tu pueblo no es como las ciudades donde tienes mas salidas.muchas gracias.baby

Object

1051Object22/06/2002 07:11:00

Bustamante cuando vendras a barcelona a firmar discos?

Object

1052Object22/06/2002 07:12:40

hola David. Algunos de tus compañeros han declarado que deseaban que se terminara Operación Triunfo (gira, triunfomania.. etc..) ¿Es ese tu caso? Que resumen harías de tu experiencia hasta ahora? Tus fans te queremos y vamos a llevar tu nombre a donde haga falta. Un besazo de Tania (BCN).

Object

1053Object22/06/2002 07:12:41

soy de cantabria y me gustaria saber cuando vienes a santander si va a ser en la plaza de toroso en la magdalena

Object

1054Object22/06/2002 07:13:29

hola DAVID!ME MOLA TU DISCO SE QUE UNA DE LAS CANCONES QUE MAS TE GUSTAN ES DUDA DE AMOR,COMPARTO LA MISMA OPINION.ME GUSTARIA SABER SI TE A PASADO ESOALGUNA VEZ.GRACIAS MARY MADRID

Object

1055Object22/06/2002 07:13:41

¿COMO TE SIENTES DESPUES DE TODO ESTO QUE TE ESTA PASANDO?¿CUANDO VIENES A FIRMAR DISCOS A VALENCIA?¿TE GUSTO EN EL CONCIERTO DE OPERACION TRIUNFO LA GENTE DE VALENCIA? PERO DI LA VERDAD POR QUE TE HEMOS VISTO EN OTROS CONCIERTOS Y SIEMPRE DECIS QUE SON LOS MEJORES¿CUAL ES EL PUBLICO QUE MAS TE A GUSTADO. DE TUS FANS ESTEFANIA Y BEA DE VALENCIA TE QUEREMOS ERES EL MEJOR.

Object

1056Object22/06/2002 07:14:01

Hola David,solo quiero decirte que te admiro como nunca he admirado a nadie y que te deseo toda la suerte del mundo en tu vida y en tu carrera,has podido comprobar que el esfuerzo vale la pena y eso nosotras lo sabemos,así que a luchar campeón,aunque te aseguro que vas a estar ahí arriba por mucho tiempo.Un beso.ROSSI(PEGO,ALICANTE)

Object

1057Object22/06/2002 07:14:33

Busta se conectara algun día a el chat?

Object

1058Object22/06/2002 07:15:06

hola busta me llamo maripi soy mexicana vivo en el df y quiero felicitarte y decirte que me muero por ti y que este verano voy a españa a santander solo para ir a tu concierto y mi pregunta es vendras algun dia a mexico? maripi gonzalez mexico df

Object

1059Object22/06/2002 07:15:40

hola david,mi nombre es norelys y soy venezolana he seguido cada momento de operación triunfo y de tu éxito,me gustaria saber si existe la posibilidad de que vengas a promocionar tu disco aqui en venezuela.

Object

1060Object22/06/2002 07:16:55

Soy periodista, en venezuela. ¿ Cuál es la ventaja y desventaja de ser tan conocido mundialmente?

Object

1061Object22/06/2002 07:18:04

¿Llego a tus manos una tarjeta de felicitación que envié a casa de tus tíos para tú cumpleaños, que decia algo así como:Has dado e gran salto,y tenia una ranita? Me haria mucha ilusión saberlo.Un beso muy fuerte de tu incondicional fan: Maria Jose Alba Brenes

Object

1062Object22/06/2002 07:18:26

soy el number one d las fans y m llamo soraya vivo en jerez cadiz m gustaria saber si abra un concierto cerca de jere m gustaria muxo bsssss tq

Object

1063Object22/06/2002 07:18:38

HOLA DAVID PARA MI SIEMPRE SERAS EL MEJOR TE QUIERO LA PREGUNTA ES ESTA PIENSAS DAR UN CONCIERTO EN HOLLANDA O POR EUROPA ? UN BESO DE UNA CHICA DE HOLLANDA QUE TE QUIERE

Object

1064Object22/06/2002 07:20:12

HOLA DAVID PIENSAS HACER MUCHAS GIRAS EN SOLITARIO O ACOMPANADO CON UNOS DE LOS CHICOS DE LA ACADEMIA ? UN BESITO DE UNA DE TUS FANS

Object

1065Object22/06/2002 07:20:55

Hola David! ¿Qué consejo le darías a alguien que su sueño es la música? Carmen Lopera(Jaén)

Object

1066Object22/06/2002 07:21:02

Hola Bustamante, me alegre mucho verte aquí en Las Palmas, así que te deseo la mejor suerte del mundo. Un beso de parte de una canariona.

Object

1067Object22/06/2002 07:21:47

DADLE ESTA PORFA,ES MI ILUSION.POR FAVOR Hola David,soy una fan de Melilla,tengo 17 años y aunq me haya quedado con las ganas de veros en concierto y de q vengas tu en solitario,ya vere q es lo q hago,pq me encantaria verte en directo.ya q tu voz es d las q no se oian desde hace tiempo.Queria felicitarte por ese pedazo de cd,q es genial.Me gustaria preguntarte si la gira es asi ya?o si pueden haber algunos cambios?tb me gustaria saber por donde te va a llevar la promocion ade+ de por España? Q sepas q siempre tendras mi apoyo,mucha suerte y sigue asi,nunca cambies

Object

1068Object22/06/2002 07:22:57

DADLE ESTA PORFA,ES MI ILUSION.POR FAVOR Hola David,soy una fan de Melilla,tengo 17 años y aunq me haya quedado con las ganas de veros en concierto y de q vengas tu en solitario,ya vere q es lo q hago,pq me encantaria verte en directo.ya q tu voz es d las q no se oian desde hace tiempo.Queria felicitarte por ese pedazo de cd,q es genial.Me gustaria preguntarte si la gira es asi ya?o si pueden haber algunos cambios?tb me gustaria saber por donde te va a llevar la promocion ade+ de por España? LAURA,MELILLA Q sepas q siempre tendras mi apoyo,mucha suerte y sigue asi,nunca cambies

Object

1069Object22/06/2002 07:24:16

eres guapo. cuando das un concierto en Barcelona? Victor Hugo Sornoza

Object

1070Object22/06/2002 07:24:17

Hola Bustamante! ¿A qué dirección de correo postal se te podría escribir?

Object

1071Object22/06/2002 07:24:59

¿Crees que es fácil que la fama te cambie como persona? Marta y Eugenia (Málaga)

Object

1072Object22/06/2002 07:25:05

Si no te dá tiempo a terminar una firma de discos,esperarias a terminar hasta la última de tus fans? tu fan nº1 Rosio-14-Málaga

Object

1073Object22/06/2002 07:25:52

CUANDO VIENES A ECUADOR Jorge

Object

1074Object22/06/2002 07:26:42

con que vida te quedas, con esta nueva o coon la de antes?

Object

1075Object22/06/2002 07:26:53

POR FAVOR PASADLE ESTA. Hola David,soy una fan de melilla,queria 1º felicitarte,por tu pedazo de voz,por tu pedazo de cd y por tu exito q te lo mereces.me gustaria saber si los sitios de la gira estan cerrados???y q me dijeras por q paises seran la promocion de tu cd,y si vas con algun compañero. De una gran fan q siempre te seguire y gracias por ser como eres.vales mucho,no cambies. BESOS LAURA.

Object

1076Object22/06/2002 07:27:27

¿david me gustaria saber si cuando cantas canciones te acuerdas de alguna antigua novia q hayas tenido?

Object

1077Object22/06/2002 07:27:27

hay alguna chica ahora en tu corazon?

Object

1078Object22/06/2002 07:28:01

que sientes cuando te dicen piropos?

Object

1079Object22/06/2002 07:29:15

tu vida era mas aburrida antes?qué hacias y qué haces ahora?

Object

1080Object22/06/2002 07:29:57

Hola David, soy Yaren de México, cuando vendras a mi país, aqui te queremos mucho y eres un angel

Object

1081Object22/06/2002 07:30:39

Has tenido una progresión impresionante y has aprovechado bien las clases de la academia, cuando todo esto se calme un poco ¿Piensas seguir estudiando o preparándote? ¿En canto, solfeo, inglés, interpretación, en otros campos.?

Object

1082Object22/06/2002 07:31:10

hola david: me perdí los conciertos de operacion triunfo porque no pasasteis por aqui y no pude acercarme a ninugo y ahora en tu gira no vienes. Además con Veronica que es mi otra favorita. A ver si puedo veros pronto y poneis a Bilbao en alguna de vuestras fechas. De todos modos, te deso todo lo mejor y decirte que tienes una voz preciosa y no cambies nunca. Una pregunta ¿hay algo que nunca hubieras hecho para conseguir llegar donde estas? Suerte!! Ainara

Object

1083Object22/06/2002 07:33:37

¿Tienes miedo a que la gente se olvide de tí una vez que acabe la promoción televisiva de operación triunfo?,¿Estás preparado para afrontarlo?

Object

1084Object22/06/2002 07:36:52

hola David me gustaria darte las gracias por ser asi pq nunca habia conocido a nadie como tu y, bueno preguntarte que le dirias a todas las chicas que mueren por ti?

Object

1085Object22/06/2002 07:37:11

Hola David Bustamante!!Soy unaaa grandidima fan tuya y me gustaria saber ¿como estas pasando este gran paso de hobrero a cantante? Espero que me contestes a esta simple pregunta.Besos!

Object

1086Object22/06/2002 07:37:30

¡TE AN OFRECIDO UN DESNUDO PARA ALGUNA REBISTA'

Object

1087Object22/06/2002 07:39:14

Busta,soy una chica de murcia q te kiere muxisimo,eres el mjr y me vuelves loca.mi sueño seria conocerte...jeje.espero poder verte de cerca en alguno d tus cnciertos q no me perdere.xcierto son ciertos ls rumores d q estas cn gisela?sigue asi campeon q llegaras lejos.tadifroa

Object

1088Object22/06/2002 07:41:07

busta me encantas,dsd el primer dia q te vi me tienes enamorada ,espero poderte conocer d cerca algun dia.xq sin ti no hay mas...te kiero!!no cambies nunca.murcianita

Object

1089Object22/06/2002 07:41:21

que sientes cuando te echan muchos piropos? guapo!!! tio bueno!!

Object

1090Object22/06/2002 07:41:34

¿Qué cosas te ha aportado la academia a nivel personal? Marta y Eugenia(Málaga)

Object

1091Object22/06/2002 07:42:49

Hola amor mio!busta me vuelves loca..eres el mjr ,dsd q te vi me enamoraste.es posible q hagas una firma d discos en murcia o algo x el estilo en el q pueda verte d muy cerca?te kiero!!tadifroa

Object

1092Object22/06/2002 07:43:01

Hola David, soy una vrdadera fan tuya y estoy loquita por ti; me gustaría conocerte algun día pero será imposible. Quería preguntarte si vas a hacer firma de discos en alguna parte de Madrid y cuándo. Bueno, guapo, muchos besos y a tus compañeros también. Mar, Madrid

Object

1093Object22/06/2002 07:43:22

que haces para estar tan bueno??? de marta para el tio mas increible del momento.

Object

1094Object22/06/2002 07:43:27

¿Es real la imagen que nos ha llegado de que eres el hombre ideal: noble, duro y viril pero dulce, sensible, romantico, cariñoso? ó por el contrario crees que no corresponde a la realidad.

Object

1095Object22/06/2002 07:44:33

HOLA BUSTA!saludos desde barcelona, en especial mios, como no!cuando sera la firma de discos en barcelona? para cuando tu segundo CD? gracias wapissimo, y muchos besos, Titin. ALAJA. (llamame si puedes al 655253471)

Object

1096Object22/06/2002 07:47:02

HOLA BUSTAMANTE: SOY UN FAN (CHICO, AUNQEU SEA UN POCO USUAL) Y PRIMERO DECIRTE, QUE ME PARECE MARAVILLOSO TU DISCO, PERO NO TANTO COMO TU VOZ. TAMBIEN ADMIRO A VERONICA ROMERO. ME GUSTARIA SABER TU OPINION SOBRE SU ESCASA, AL MENOS BAJO MI PUNTO DE VISTA, INTERVENCION. MUCHAS GRACIAS Y AUPA CON TU CARRERA, QUE TODAVIA TE QUEDA MUCHO CAMINO, LO SE. CGM.

Object

1097Object22/06/2002 07:48:14

Bustamante tu disco me a gustado mucho¡¡¡¡me lo pongo todos los dias.Ya se que es muy pronto pero ¿cuando sacaras el siguiente disco?Muchiiiisimos besos de tu fan Lorena.

Object

1098Object22/06/2002 07:48:54

Hola como estas soy carlyn de costa rica busta vendras aqui a promocionar tu cd te estamos esperando aciosos busta no sabes si atro de ot vendra a costa rica busta mi email es carmiarbu12@hotmail.com besos tu fan numero 1 CARLYN

Object

1099Object22/06/2002 07:49:54

Somos 3 chicas de palau de plegamans (bcn)somos muy fan tuyas i queriamos saber unas cosillas: 1º-Cuando vendras al corte ingles de sabadell a hacer la firma de discos¿? 2º- Estas con gisela¿? 3º- Todavia vives en "SAN VICENTE DE LA BARQUERA"? 4º-Como te va la gira de tu disco¿? UN BESO DE TUS ADMIRADORAS NUM. 1 (Jessica,Nuria y Laura)

Object

1100Object22/06/2002 07:50:26

hola bustamante te escrive mario castro de HONDURAS y te escrivo para felicitales mi pregunta "como te a cambiado tu vida la fama "me puedes enviar el correo de tu clud de fans el mio es rodolfo61hn@yahoo.com e querido ponerme en contacto con ustedes pero no lo e logrado ayuda porfavor

Object

1101Object22/06/2002 07:52:40

porque no vienes a dar un concierto a Lleida? anna

Object

1102Object22/06/2002 07:53:50

hola bustamante mi pregunta es como te cambio la vida la fama"escriveme a mi correo rodolfo61hn@yahoo.com mario castro honduras

Object

1103Object22/06/2002 07:54:25

te podrias enamorar de una de tus fans??????de cuantos años te gustan que tengan tus novias?????un besazo wapo!!te quiere Rebeca d Madrid.

Object

1104Object22/06/2002 07:55:02

hola david, soy un chico al cual le gustaria saber ¿por qué te depilas es pecho?Yago (Jaén)

Object

1105Object22/06/2002 07:56:19

hola David, soy una chica de Jaén, a la que le gustaría saber que rollito hay entre tú y Gisela. Espero que os vaya bien, y que triunfes porque te lo mereces. UN BESAZO. MUACKS GUAPO. ERES EL MEJOR DEL MUNDO.

Object

1106Object22/06/2002 07:57:48

Bustamante ¿que tal te va con Gisela?.

Object

1107Object22/06/2002 07:58:16

Hola David.Tienes miedo de q este boom baje,y de q todo esto se vaya alejando?(aunque seguro qtu seguiras por muchisimo tiempo y hasta el final)pq voces como las tuyas no las hay y hay q cuidarlas mucho)para no perderlas. muchos besos para el mejor,LAURA,MELILLA

Object

1108Object22/06/2002 07:58:32

Hola David, ¿crees que vas a tener tiempo de seguir estudiando como decías que harías al salir de la academia, o ahora que ya eres famoso no lo necesitas?. Un besazo campeón, tu disco es ¡ALUCINANTE!

Object

1109Object22/06/2002 07:58:39

Bustamante ¿que tal te va con Gisela?.Besos Lorena.

Object

1110Object22/06/2002 08:01:09

¿por que te saliste de estudiar?, ¿como te cuidas?¿por que eres tan guapo?

Object

1111Object22/06/2002 08:01:21

Hola corazón! Cuentamé el día más emocionante que has vivido hasta ahora. Ese día que te acostaste y no te podías dormir pensando en lo que te había ocurrido. Un besazo. Marta (Rivas Vaciamadrid)

Object

1112Object22/06/2002 08:01:52

Hola David: ¿Al entrar en la Academia,en qué puesto te situaste entre tus compañeros;t veías un alumno discreto y prudente,o por e contraio un alumno aventajado?Otra cosa,cada vez que escuchas una canción tuya,¿qué sientes?.Salu2.Dani Virum

Object

1113Object22/06/2002 08:02:51

Hola David,te hemos visto con una cancion y un duo genial,en tu cd.Con quien te gustaria hacer duos en proximos cds?no cambies,q vales mucho y tu cd tb,vaya voz. Muchos BESOS,Y NO CAMBIES. LAURA,MELILLA. SIEMPRE TE APOYAREMOS.

Object

1114Object22/06/2002 08:03:04

¿Porque no cantaste la cancion de( NO SOY UN SUPERMAN )en el concierto del Bernabeu.

Object

1115Object22/06/2002 08:03:19

David, ¿qué es lo que menos te gusta de todo lo que te está pasando?, un beso y cuidate, ¡eres genial!

Object

1116Object22/06/2002 08:03:38

¿Porque no cantaste la cancion de( NO SOY UN SUPERMAN )en el concierto del Bernabeu.Muchiiiiiisimos Besos Lorena.

Object

1117Object22/06/2002 08:04:00

Hola David! Me gustaría saber qué te queda aún por conseguir, cuales son tus metas, tus sueños por cumplir. Eres el mejor. Besos. Marta

Object

1118Object22/06/2002 08:04:16

Hola precioso soy Elvira de Tenerife la rubia del pase vip.Oye me han comentado que despues de este disco descansaras una temporada larguilla¿es verdad corazon?Un besazo y muchisimas felicidades por tu gran disco campeon.Ah recuerdos de Christian mi niño el de los muñecos Chao.

Object

1119Object22/06/2002 08:06:24

¿A parte de las canciones melódicas,que tipo de canciones te gustan Bustamante?Muchiiiiiiisimos besos Lorena.

Object

1120Object22/06/2002 08:06:37

Hola, me gustaría saber por qué volviste a fumar después de tantos meses en la academia sin hacerlo, ¿no será que lo hiciste para caer mejor a la gente, piensas volver a dejarlo?

Object

1121Object22/06/2002 08:06:53

Hola David. Soy una calceatense, que además de por tu voz, quedo prendada por tu personalidad. Mi pregunta: el día 7 vienes aquí junto con Verónica ( a Santo Domingo de la Calzada ), y me gustaría saber si vais a poder firmar discos y demás, ya que ese momento es ("casi")único en la vida. Un beso muy grande. No cambies nunca, y que todo este éxito no eclipse tu verdad. Estela.

Object

1122Object22/06/2002 08:08:25

Hola David.¿te gustaria hacer tus propias canciones en proximos cds?pq creo q en ti eso va a ser muy bueno,ya q tienes una gran sensibilidad,y mucho q transmitir.me encanta como transmites tus canciones.vaya voz. David valesmucho.MUCHOS BESOS Y SUERTE.LAURAMELILA

Object

1123Object22/06/2002 08:09:00

¿que sentiste el otro día al llegar a "casa" y ver que al pasar los días la gente te sigue apoyando tanto a tí como a tu familia? besines de carmen mero...

Object

1124Object22/06/2002 08:09:56

hola busta!me llamo ali y soy de tu tierruca, de cantabria. Solo una pregunta, ¿cual fue tu primer sentimiento al salir al escenario del palacio de festivales de santander y ver que todos los que estabamos alli nos rendimos a tus pies?. Estuviste genial, como siempre, y que sepas no voy a olvidar nunca esa noche tan maravillosa que nos hiciste pasar. Sigue asi busta, eres el mejor artista y la mejor persona y que sepas que siendo asi como eres has ayudado a muchisima gente, y entre todos a mi. Muchas gracias por todo lo que nos has dado y te deseo lo mejor del mundo campeon!!. Un beso.

Object

1125Object22/06/2002 08:10:02

HOLA GUAPISIMO.QUE SEPAS QUE TIENES UN DISCO PRECIOSO DESDE LA PRIMERA CANCIÓN HASTA LA ÚLTIMA.ME GUSTARIA SABER SI VAS A VENIR A ALGÚN LUGAR DE CANTABRIA A FIRMAR DISCOS.BUENO, MUCHISIMOS BESOS Y ESPERO QUE SE CUMPLA ESO DE "BUSTAMANTE DISCO DE DIAMANTE".TAMARA

Object

1126Object22/06/2002 08:10:42

podrás vivir cerca de todos a la vez...? si verdad te llevamos en nuestro corazón.besos unquera carmina

Object

1127Object22/06/2002 08:12:18

Crees que volveràs a hacer de paleta o seguiras cantando?

Object

1128Object22/06/2002 08:12:35

Hola David.haras galas tb en invierno como alguno de tus compañeros?espero q para entonces vengas para melilla,q aki t keremos ver. muchos besos david y suerte.LAURA MELILLA

Object

1129Object22/06/2002 08:15:03

¿Cuando vienes a México?Cristina México

Object

1130Object22/06/2002 08:16:09

OLA BUSTAA!SE QUE ESTO TE LO DIRAN MUCHOS/AS PERO SOY TU FAN NUM 1!!!ME LLAMO CARLOS TENGO 15 AÑOS,VOY A UNA ESCUELA DE CANTO!Y ME GUSTARIA QUE ME DIJESES Q PASOS DEBO TOMAR EN LA MUSICA!ERES EL MEJOR!BYE

Object

1131Object22/06/2002 08:16:29

Hola David,¿q dirias de tu cd y q puede encontrarse?por si kida alguien q no lo haya escuchado,q lo dudo.yo de toas formas animo a to el mundo,pq es bueniiiiisimo,me encanta tu cd y tu voz,vales mucho. Muchos BESOS Y SUERTE,DE TU FAN,LAURA,MELILLA

Object

1132Object22/06/2002 08:17:07

¿Cuando vais a Mexico?

Object

1133Object22/06/2002 08:17:33

¿me gustaria sabes si alguna vez has querido presentarte a algo y te han dado con la puerta en las narices? si lo hicieron que necios fueron porque tu vales mucho tira pa alante que yo te apollo disco 20.maria manilva.

Object

1134Object22/06/2002 08:18:24

He visto las fechas de tus giras y me he fijado en que no vienes a Salamanca ni por aquí cerca; ¡¡¡Casi ni te acercas a Castilla y León!!! ¿Nos tienes olvidados? Cuál es el lugar más cercano a Salamanca al que vienes? Contesta, por favor. Mil besos, guapo.

Object

1135Object22/06/2002 08:18:36

No tengo nada q preguntar pero te quiero mucho,tengo todo tuyo el CD Y mucho más. TE QUIERO MUCHO,MUCHO BESOS MARCELA SILVA MACIEL

Object

1136Object22/06/2002 08:20:45

ESTAS REALMENTE CONTENTO CON TU DISCO O CREES QUE SE PODIA AVER MEJORADO???

Object

1137Object22/06/2002 08:20:54

Hola David.Me llamo Anna y soy de Palamós.Yo sólo queria comentarte que tu música me ha alegrado muchisimo la vida y que soy muy feliz de que vengas a mi pueblo dentro de 2 semanas. Gracias por ser como eres. Un beso.

Object

1138Object22/06/2002 08:21:39

hola busta soy noe d madrid y te qiero preguntar q si es verdad q estas saliendo con gisela?me lo dijo mi hermana pero nose si es verdad pero q sepas q tengo tu cd y q nunca te abandonare BUSTA ERES EL MEJOR TKM

Object

1139Object22/06/2002 08:22:38

OLA ME LLAMOS CHARLIE TENGO 14 AÑOS Y ME GUSTARIA QUE DESPUES DE HABERTE APOYADO TANTO QUE TE MOJASES Y ME DIJESES QUE DE ENTRE TODOS LOS DISCOS DE TUS COMPIS CUAL ES EL QUE CREES Q TIENES MAYOR CALIDAD(DIME UNO)GRACIAS!!!THE BEST!

Object

1140Object22/06/2002 08:23:46

¿Por qué no vienes a Granada en tu gira? Va a ser una pena quedarnos sin verte

Object

1141Object22/06/2002 08:25:14

Hola David. Me llamo Anna y soy de Palamós. Mas que una pregunta, queria comentarte algo. Tu musica me ha alegrado mucho la vida, y que estoy muy contenta de que vengas a mi pueblo dentro de 2 semanas. Gracias por ser como eres. Un beso.

Object

1142Object22/06/2002 08:27:07

Hola Busti!!! ¿Qué tal? Primero decirte que eres el mejor, y segundo, que si te has olvidao de nosotros, los Salamantinos, porque ni te acercas pa' esta zona. ¿Cuál es el sitio más cercano al que vienes? Contesta, guapo. Besos

Object

1143Object22/06/2002 08:28:01

somos conchi y rebeca y queremos saber que significa para ti el tatuaje que tienes en el brazo?

Object

1144Object22/06/2002 08:30:41

¿q es lo primero q pensaste cuando viste la cara de emocion de tus padres?

Object

1145Object22/06/2002 08:31:04

soy una super fans tuya y me encanta tu disco.me gustaria saber que debo hacer para yegar ahi donde estas ,quiero ser cantante pero por la vergüenza no se lo digo a mis padres y creo que no valgo porque no lucho.creo que nunca podre llegar ahi.animame y dame una respuesta.un beso ana maria.

Object

1146Object22/06/2002 08:31:42

si una chica de 14 años quiere ser cantante ¿ que consejos le das. es muy difisil grabar un disco?mandame a tu productor para que me escuche cantar

Object

1147Object22/06/2002 08:32:01

hola tintín!! somos dos fans mallorquinas tuyas incondicionales... eres un artista como el que mas..te queremos muchísimo y esperamos que sigas siempre en la música, ya que escucharte es un regalo para nuestros sentidos... pregunta: vas a venir a mallorca en concierto? vas a venir a firmar el disco? bueno un beso inmenso bombonazo que eres precioso, adios!!

Object

1148Object22/06/2002 08:32:16

¿Cúando y dónde va a ser la firma de autografos en Santander? Un BESADO de Esmeralda y Azucena de Santander.

Object

1149Object22/06/2002 08:34:28

hasta donde crees que se escuchan tus canciones porque aqui en guatemala yo soy tu fan numero uno

Object

1150Object22/06/2002 08:36:49

sabes hasta donde ha llegado tu musica porque aqui en guatemala yo soy tu admiradora numero uno carolina O.

Object

1151Object22/06/2002 08:38:35

david soy una fans tuya me encanta como cantas y mi padre estuve en tu pueblo soy una niña de 12 años pero con perdon pero estas buenisimo.vamos a la pregunta,¿piensas q eres el mismo o la fama se te suvio a la cabeza?una fans tuya te quiero bustamante tengo tu colonia tengo tu mini libreta tengo fotos tuyas de pequeño mayor ect.ect.tengo tus discos tengo todo,o bueno casi todo yo se q esta carta la vamos a llamar asi no te llegara pero si te llega acuerdate de una amiga ASTURIANA.besos de una amiga.posdata:mi padre trabajo en la construcion y ladrillos.jajajajaja.

Object

1152Object22/06/2002 08:39:10

¿Que sientes al ser cantante?

Object

1153Object22/06/2002 08:39:34

¿david crees q eres el mismo o sete suvio la fama a la cabeza?

Object

1154Object22/06/2002 08:39:45

Hola David:Soy d tu tierra, de Vega de Pas, tierra del sobao y de la quesada. T animas a hacernos una visita?

Object

1155Object22/06/2002 08:40:19

¿Hay alguna chica que en la academia hayas sentido por ella algo mas que amistad??

Object

1156Object22/06/2002 08:40:29

Hola Bustamante!!! Soy una chica de Suecia. Mi pregunta es: que cansion es tu favorita de tu disco?? Tambien te quiero decir que eres el mejor y buena suerte en el foturo!! Un beso muy grande -Susan

Object

1157Object22/06/2002 08:40:54

Hola Busta soy Nerea de Bilbao y me encanta todas tus canciones solo me gustaria saber si realmente, auenque lo niegas, estas saliendo con Gisela y si no, te gustaría? un beso mu gordo Nerea

Object

1158Object22/06/2002 08:41:16

¿Que cosas te dan enormemente verguenza?

Object

1159Object22/06/2002 08:42:32

¿Cuando vendras para Puerto Rico? Me encantaría que fuera pronto!!

Object

1160Object22/06/2002 08:42:47

¿David cuando hagas tu gira internecional vas a incluir a Uruguay?

Object

1161Object22/06/2002 08:43:21

Como haces para que a pesar de haber subido tan rapido sigas siendo un chico tan noble de sentimientos y tan sencillo? Te admiro por eso. Soy enamorada21 en el foro de Portalmix y Maria de Asturias (¿te acuerdas del pase de Santiago de Compostela?)(yo soy la de la muleta) TE QUIERO

Object

1162Object22/06/2002 08:43:32

q se siente al ser tan querido por la gente? Eres consciente de donde estas? Q darias por un minuto de tranquilidad, de sosiego? Q opinion t merece este revuelo q se ha armado alredor de ti? Sabes cual es el limite de tu voz?

Object

1163Object22/06/2002 08:44:14

¿Cuando vendrás para Puerto Rico? Me encantaría que fuera pronto!!!

Object

1164Object22/06/2002 08:47:39

¿QUE TAL JUGABAS AL FUTBOL DE PEQUEÑO?.LORENA DE MÓSTOLES

Object

1165Object22/06/2002 08:49:02

Cuando vendras a firmar discos a barcelona? Donde te encontrarás?

Object

1166Object22/06/2002 08:49:52

con tan poca edad no te asusta creertelo demasiado

Object

1167Object22/06/2002 08:51:01

como me puedo hacer de tu club de fans

Object

1168Object22/06/2002 08:51:28

¿QUE PENSASTE CUANDO TERMINASTE DE GRABAR TU DISCO?¿QUE SENSACIONES TUVISTE?LAURA DE MADRID.MUCHOS BESOS Y QUE TRIUNFES MUCHO PORQUE TE LO MERECES CON TODO MI CORAZON.TE QUIERE UNA SUPER FAN QUE VA A SANTANDER DE VACACIONES.

Object

1169Object22/06/2002 08:51:53

hola david!!1 soy natalia desde bilbao. mi pregunta es que a ver si vas a pasar por mi ciudad en tu gira en solitario porque tengo un monton de ganas de verte, sabes???

Object

1170Object22/06/2002 08:51:56

ola!!!!!!! somos jenni y lucia d valencia eres muy guapo estas muy bueno y nos gustaria q binieras aqui a firmar discosa esperamos tu respuesta adios!!!!!!! besos guapeton

Object

1171Object22/06/2002 08:52:38

Vas ha venir a Tenerife a firmar discos, ya que no vienes para un cocierto, por favor

Object

1172Object22/06/2002 08:53:50

Soy AlejandroTR de Valencia. Dijiste en una gala de triunfomania q una falla de Valencia te havia hecho "Fallero de Honor" ¿me podrias decir q falla es? MUCHISIMAS GRACIAS!!!!!

Object

1173Object22/06/2002 08:54:33

Sy laura, una chica d bcn d 13 años k me encanta tu disco, en las fotos stas wenisimo, una cosa; ¿Cuando vas a acer el cncierto en barcelona? NO ME LO PERDERÉ. TK

Object

1174Object22/06/2002 08:57:04

David, cuando estabas en la Academia, uno de los concursantes te sacó tarjeta roja, al apoyar a una de las chicas y otro te salvó, pero no sabía que ibas a ser finalista. Hoy los dos triunfan igual que tú. Pero ¿ no piensas que ahí hay enterrada una "espinita" ? ¿Sientes la sombra de ambos o de verdad son amigos? Yo creo que hay para todos y que tú eres el mejor y más noble de los tres. Exitos. Un beso desde Caracas. Judith V.

Object

1175Object22/06/2002 08:57:36

vas a pasar por tenerife a firmar los discos y tambien en la gira

Object

1176Object22/06/2002 09:03:40

hola busta.¿Por qué no comprtes escenario con Gisela o ustedes no elegiis las parejas?

Object

1177Object22/06/2002 09:05:10

Primero de todo decirte que eres de lo mejor q hay en este momento y muchas felicidades por tu disco porque es genial.Me gustaria saber si tienes planeada firma de discos en Valencia. Espero con impaciencia el concierto con Veronica(soys los mejores!).Muchos besos guapisimo!MARTA

Object

1178Object22/06/2002 09:06:01

hola soy María una chica de Zaragoza que te sigue desde el principio.Pienso que tines una de las mejores voces y además eres autentico y muy buena persona lo que te hace único.Pude verte en concierto en mi ciudad y descubri que no solo es cosa de la tele que sigues siendo el mejor en persona.Me gustaria saber si vas a venir a firmar discos por aqui??muchos besos y no cambies nunca

Object

1179Object22/06/2002 09:08:13

Hola david soy joana de sansebastian 16 años dsd el 1 dia q te vi supe q eras mi idolo te quiero muchisimo tu voz no la supera nadie!te tengo en las paredes de mi cuarto por todos lados,fijate q tengo la portada de el cd entero pegado en la pared tbijji.mi pregunta es esta porq no vas a venir a sansebastian¿?¿?joooo q me heche dos dias llorando,bueno no pasa nada intentare hacer lo posible para verte me ire hasta sanvicente o a coruña contestame porfavor te quiero MUCHO ERES MI IDOLO!!GRACIAS POR HACERME FELIZ BESOS JOANA

Object

1180Object22/06/2002 09:08:38

busta eres el mejor cantante q a visto la musica en estos años y si alguien se merece el disco d diamante ese eres tu. tu y alex sois la alegria del mundo sin vosotros no vivo.¿como puedes tener esa voz tan bonita, cantar tantas horas seguidas y no quedarte afonico?

Object

1181Object22/06/2002 09:13:07

soy una gran admiradora tuya desde que empezo O.T.Me pareceq tienes una voz prodigiosa y dulce.¿vendras de concieto a valladolid?un beso.vane

Object

1182Object22/06/2002 09:13:26

Hola David! Quiero que sepas que para mí eres el mejor,además de guapísimo y super simpático. por cierto, tu disco es genial. Me gustaría saber cuándo vas a venir a firmar discos a Madrid, porque estoy ansiosa por verte. Te quiero un montón, no cambies nunca! BESOS. Claudia.

Object

1183Object22/06/2002 09:14:14

Busta para mi has sido y seras el mjor pero desde aqui de potes queremos saber si estas con Gisela es muy importante.Muchos besos wapisimooooooooooooo!!!!!!!!

Object

1184Object22/06/2002 09:14:47

¿que es lo peor y lo mejor de la fama?un besazo de una admiradora.vane.ERES EL MEJOR!

Object

1185Object22/06/2002 09:14:54

¿Cómo hace David Bustamante para mantenerse tan hermoso y atractivo todo el tiempo? ¿Cómo podríamos hacer para conocernos personalmente con David? VALLEJO, MARTIN VALLEJO, JESSICA DE (BARRANQUERAS)CHACO, ARGENTINA. SUPER FANAS DE DAVID!!!

Object

1186Object22/06/2002 09:15:30

¿Sueles salir de marcha cn tus amigos?o eso ya no existe en tu vida actual?un besito.vane

Object

1187Object22/06/2002 09:17:22

Busta desde potes te adoramos ers nuestro idolo. Tu segundo single podia ser Cantabria, asi estariamos mas orgullosos de ti de lo que estamos, ¿lo haras?Te queremos muchisimo desde Potes.MONY!!!!

Object

1188Object22/06/2002 09:17:52

DAVID: ¿TENES NOVIA? ¿TE GUSTA ALGUNA PARTICIPANTE QUE FUE TU COMPAÑERA EN LA ACADEMIA? ACERCA DE TU MADRE: ¿PODRIAS CONTAR? (SI SE PUEDE SABER). VALLEJO, MARTIN. VALLEJO, JESSICA. CHACO, ARGENTINA.

Object

1189Object22/06/2002 09:19:27

GISELA Y TU TENEIS UNA AMISTAD MUY BUENA. PERO SOLO ES UNA AMISTAD O HAY ALGO MAS QUE ESO QUE TEPARECE GISELA COMO AMIGA Y COMO NOVIA.UN BESO ERES EL MEJOR DE TODOS.VIVA EL BARQUEREÑO.

Object

1190Object22/06/2002 09:19:37

hola, busta, eres el mejor, me encantas y tu disco es genial.he escuchado que ibas a venir a jerez de la frontera a firmar discos, ¿es verdad? un beso

Object

1191Object22/06/2002 09:20:53

Bombonazo!!!que pedazo de disco,m enkanta...como tu,bufff,k grande eres!tng unas ganas de tu gira,staré la primera,spero k te dejes ver x aki,oks?!?...1besazo de una valenciana...esther

Object

1192Object22/06/2002 09:21:01

busta,cuando vas a venir a firmar a madrid.dinos sitio y hora.david eres el mejor te queremos.te puedo pedir un favor,me puedes mandar una foto dedicada,mi direccion es:C/Leon XIII N3 2A C.P.28820 Coslada Madrid .Mari Carmen Prado Artero.GRACIAS TE MERECES LO MEJOR.

Object

1193Object22/06/2002 09:22:28

eres el mejor ME PODIAS DECIR SI VAS A VWENIR EN TU GIRA DE VERANO A LOGROÑO DDONDE SE VENDERAN LAS ENTRADAS CTT

Object

1194Object22/06/2002 09:25:05

David te gustaria que alguna gente dejara de meterse contigo o te da igual?yo me cabreo mucho cuando lo hacen eres el mejor.un beso

Object

1195Object22/06/2002 09:26:59

¿Vas a venir a Logroño?

Object

1196Object22/06/2002 09:30:01

HOLA MAITIA!!VAS A VENIR A ZARAGOZA EN TU GIRA?ESPERAMOS KE SI,YA K CUANDO VINISTEIS TODOS NO KDABAN ENTRADAS Y ESTUVIMOS EN EL HOTEL PERO SOLO PUDIMOS HABALR CON MANU. POR CIERTO LE DIMOS UN ANILLO PARA TI A TU MANAGER, CREO K ERA ARGENTINO, Y NO TE LO VIMOS EN LA ENTREVISTA DEL DIA SIGUIENTE.K BUENO ESTAS EN LAS FOTOS DEL DISCO, ERES LA OSTIA, VUELVE A CRONICAS Y MARCATE UN STRIPTEASE CON BORIS.UN BESICO DE ANA Y KRIS.TE ESPERAMOS

Object

1197Object22/06/2002 09:30:28

TIENES NOVIA DAVID? ERES UN PAPASITO RICO

Object

1198Object22/06/2002 09:31:45

Vendras de gira por Tenerife?

Object

1199Object22/06/2002 09:32:06

david cuando vas a venir a oviedo a firmar discos? te estamos esperando.. :)te keremos, 1besazo

Object

1200Object22/06/2002 09:33:10

¿Qué les dírias a las personas que se presentaron en los primeros castings y no pasaron a la primera edición de O.T.? Lidia Del Rio, Muuuchos besos!!

Object

1201Object22/06/2002 09:33:15

hola david soy una peruana que tu el gusto de verlos a todos en ot ¿cuando vas a presentar tu disco para que este al alcance de todo el mundo y que no sea por internet?

Object

1202Object22/06/2002 09:37:22

tenes novia

Object

1203Object22/06/2002 09:43:02

Holaaaa!!!!! busta somos Mari y Carmen de Mallorca 2 fans tuyas, casadas q te queremos muxo!!! y te deseamos lo mejor del mundo!!!! nos gustaria saber cuando vas a venir a mallorca a firmar discos???? y que piensas sobre la pirateria??? gracias!!!! muxos besos

Object

1204Object22/06/2002 09:44:28

Ahora estoy escuchando tu cd. Que por cierto ¡¡peazo de cd!! te felicito. Me gustan todas las canciones pero hay una que me ha hecho llorar varias veces, la de Si Tengo Que Morir. Que bonita es! Y con tu voz aun lo es muchisimo mas! Te diré lo tipico aunque supongo que lo debes tener muy rallado, siento si te molesta, pero necesito decirtelo. No solo has me has conquistado por tu voz y por tu belleza, mas que nada me has conquistado por tu persona. Eres tierno, dulce, simpatico... que daria yo por un chico como tu!! Y si encima canta tan bien ya seria la ostia (perdon). Pero eso es imposible porque como tu ninguno. Asi que me comformo con soñar... Espero que todo te vaya como hasta ahora y que seas una estrella de la cancion porque vales mucho y sinceramente, Te Lo MeReCeS! Te seguire apoyando todo lo que haga falta y te llebare en mi corazon siempre. Espero volverte a ver porque la ultima vez que te vi estabas dentro del autobus y solo me hablaste a través del cristal y me gustaria muchisimo hablar contigo sin cristales por enmedio. Y cuidanos en el club de Fans porque la gente que hay es majísima y me alegro muchísimo de haberlas conocido!! Un beso enorme de una Catalana que seguria luchando por ti lo que haga falta. Ojala pudieras contestarme y sino puede ser me conformo con que lo hayas leido. Irmina Merino

Object

1205Object22/06/2002 09:46:13

Soy Mari de Barcelona, no creo que te acuerdes de mí... :( Te regale un anillo junto con Thaís que entro a verte en el cncierto del dia 10 d Abril en Barcelona. Tambien estuvimos cn tu primo Roberto en el aeropuerto, es majiiisimo. Nos dijo que t pusiste nuestro anillo y no nos lo podiamos creer... eres lo mejorrr!!! Bueno artista, este verano espero poder ir a verte donde sea porque kiero agradecerte en persona todo lo que has hecho todo este tiempo, que se que tu diras que todo lo hemos hecho nosotros... pero no kariño, todo lo has hecho tuuuu!! La gala especial en Cantabria fue muy muy emocionante, kon decirte que todos los del foro en esas horas no pudimos contener las lagrimas... yo me repetia una y otra vez que todo eso no es nada comparado con lo que tu te mereces.. Espero que, kuando hagas tu concierto en San Vicente te podamos devolver un pokito mas d amor y cariño. Nunca se que mas decir kuando me despido. Que te voy a decir??? Lo que tu ya sabes, que tu foro estara contigo pase lo que pase que vamos a cuidar de ti, que te vamos a seguir apoyando pase lo que pase y que por nada del mundo cambies. Muuchos besitos. "Eres mi estrella" Mari.

Object

1206Object22/06/2002 09:46:51

hola david soy una gran fan tuya me llamo amanda y con este mensaje te kiero decir que eres mi idolo y que me encanta como cantas, tambien me gustaria felicitarte por tu disco , es una pasada. Kiero q sigas asi de bien como hasta ahora llegaras muy lejos. Decirte tmb que como a mas de no se cuantas chicas m has robado el corazon, y una cosa tmb importante tu pueblo es precioso yo tengo unas amigas que son tambien de cantabria pero el pueblo se llama Castro Urdiales. Y bueno aver si llega pronto ya tu gira en solitario y vienes pa madrid y estas tan genial como estuviste en la gira de o.t. Besazos super fuertes de una fan q esta loca por ti , y q t admira muchisimo. amanda

Object

1207Object22/06/2002 09:47:18

somos 3 chicas d murcia muy fans tuyas:marta,maria,inma,cuando vengas el 10 d septiembre al cuartel d artilleria d murcia vamos a ir a verte, esperemos k nos dediqes la cancion d no soy un superman o además d ti(si pudiera ser) 6 besos(2 d cada una).

Object

1208Object22/06/2002 09:48:38

apar tir de que edad te gustan las pivas

Object

1209Object22/06/2002 09:48:45

Querido David , Saludos desde Canada , te deseo lo mejor y que tu cd es buenisimo. Mi pregunta es: como te sientes de saber que tienes fans por todo el mundo? Te quiero mucho. Johanne ( montreal,canada)

Object

1210Object22/06/2002 09:50:30

me gustaria que vinieras a zaragoza? silvia

Object

1211Object22/06/2002 09:51:19

son tu fan ?me gustas mucho

Object

1212Object22/06/2002 09:51:58

David: hola, soy Maria Jose de Chile, tengo 20 años y quiero decirte que me encanta tu musica y todo lo que haces, y me gustaría saber si tienen pensado hacer una gira por Sudamérica o si lo harías en solitario y cuando. Por favor si puedes contesta esta pregunta. Tu fiel admiradora... Maria Jose.

Object

1213Object22/06/2002 09:53:35

soy de argentina ¿Alguna vez vas a venir a mi pais? un besote grande ESTAS RE-BUENO NATY 19 -CARLA 17- NATY 17 TE AMAMOS Nº TELEFONO (0297)4467989 LLAMAR

Object

1214Object22/06/2002 09:54:10

soy de argentina ¿Alguna vez vas a venir a mi pais? un besote grande ESTAS RE-BUENO NATY 19 -CARLA 17- NATY 17 TE AMAMOS Nº TELEFONO (0297)4467989 LLAMAME

Object

1215Object22/06/2002 09:54:24

Hola David, en primer lugar felicitarte eres la caña, enhorabuena pq eres el mejor, bueno te queria preguntar si vas a venir por Granada en tu gira.felicidaes por tu disco es la hostia, perdon,adios, bye. de J:M

Object

1216Object22/06/2002 09:55:15

Hola soy Alba Prados y soy una gran fan de David Bustamante y queria saber cuando vendra en solitario a Tarragona gracias

Object

1217Object22/06/2002 09:55:57

ERES EL MEJOR DAVID

Object

1218Object22/06/2002 09:57:53

Hola soy tu fan número uno, ¿vas a venir a Murcia?, te esperamos, un beso muy fuerte y hasta pronto.

Object

1219Object22/06/2002 09:58:29

Que ha supuesto para ti tener tanto exito con tu disco, y estar en los primeros puestos de las listas de ventas en tan poco tiempo? Como ha afectado todo este fenomeno en tu vida privada? Un beso de Ana Martinez de los Rios, la chica del aeropuerto del dia de nochebuena.Santander

Object

1220Object22/06/2002 09:59:26

BUSTA! SOY DANI DE MARBELLA, MI PREGUNTA ES: ¿PORQUE LA GIRA CON VERO? ¿PORQUE ELLA? PARA QUE TE ALEGRE EL DÍA? ME ENCANTAIS LOS 2

Object

1221Object22/06/2002 10:00:32

Que es lo que menos te gusta de ser famoso? Susana Martinez Gomez

Object

1222Object22/06/2002 10:00:36

Queria saber si vas a venir a firmar discos a Madrid,si me puedes decir cuándo y dónde los vas a firmar.Estaré esperándote.Un beso de alguien que te quiere: Toti.

Object

1223Object22/06/2002 10:00:57

hola!!!! me gustaria saber si vas a hacer firma de discos en sabadell, y si la haces cuando. muchas gracias guapo eres el mejor. besos.marta 14 años sabadell.

Object

1224Object22/06/2002 10:01:26

Sou de Portugal e queria perguntar quando pensas em vir actuar cá?? Existem muitos admiradores de Operação Triunfo em Portugal ansiosos por vos ver ao vivo!! Beijos e felicidades

Object

1225Object22/06/2002 10:02:00

¿CREES QUE LA FAMA SERÁ TRANSITORIA POR EL BOOM DE OPERACIÓN TRIUNFO O QUE REALMENTE DURARÁS? OTRA VEZ DANI DE MARBELLA

Object

1226Object22/06/2002 10:02:15

OLA ME LLAMO MAMEN Y SOY UNA CHICA Q TIENE TU MISMO SUEÑO TRIUNFAR SIENDO UN GRAN CANTANTE COMO TU. TU CREES Q DEBO SEGUIR LUCHANDO POR LO Q QUIERO COMO TU LO AS ECHO O DEJARLO?? XQ A TI TE A COSTADO MUXO ESTAR DONDE ESTAS

Object

1227Object22/06/2002 10:02:26

Hola David queria saber como te sentias cuando a pesar de todas las nominaciones te salvavas llegando incluso a ser el 3ºfinalista.Ademas el conseguir el record de ventas en menos tiempo. Te quiere Noe_Granada

Object

1228Object22/06/2002 10:03:10

hola!!! me gustaria saber si vas a venir a hacer firma de discos a sabadell, si la haces cuando. eres el mejor. besos, marta 14 años sabadell.

Object

1229Object22/06/2002 10:06:52

Hola David! Soy una gran fan tuya, de un pueblecito de Tarragona,concretamente de la Pobla de Mafumet. Quiero que sepas que gracias a ti, he superado una depresión y que me has hecho llorar. Por eso me gustaría saber si me podrías enviar algo tuyo. Un Beso!, Te quiere tu club de fans de la Pobla

Object

1230Object22/06/2002 10:07:07

¿¿Crees que algun dia podras estar junto a Gisela, pero no como amigos, sino como pareja??

Object

1231Object22/06/2002 10:08:07

¿Cómo te sentiste el sabado al enterarte del atentado en Santander ?

Object

1232Object22/06/2002 10:08:21

bustamante soy una fan tuya numero uno donde las haya y estoy loca por ti,como te presentaste a operacion tiunfo?q tal las ventas de tu disco?pq es un exitazo,te sigo el todos los progrmas.este verano voy a tu pueblo solo pq eres de alli y te lo mereces.desde q te vi en el concierto de todos me deslumbraste.te kiere muchisimo.lidia de madrid

Object

1233Object22/06/2002 10:08:59

¿Algun día pensaste que tu gran sueño pudiera hacerse realidad?

Object

1234Object22/06/2002 10:10:15

busta ERES EL MEJOR.PERO CUANDO IRAS A FIRMAR A BARCELONA?

Object

1235Object22/06/2002 10:13:55

hola wapo!¿Cómo te ves dentro de 50 años?

Object

1236Object22/06/2002 10:14:48

Hola Wapo!¿Cómo te ves dentro de 50 años? Mariapi (zaragoza)Ole maños. olé!!

Object

1237Object22/06/2002 10:15:23

Hola me llamo Èrika y soy de Granollers ( Barcelona) me gustaria hacerte una pregunta . Para un futuro , piensas hacer algun duo con alguno de tus compañeros de operacion triunfo y sacar uno o mas discos??

Object

1238Object22/06/2002 10:15:56

HOLA DAVID! SOY UNA ECUATORIANA FANÁTICA HASTA LA MUERTE DE TI, AQUÍ RECIEN ESTÁN PASANDO OPERACIÓN TRIUNFO Y ES UN ÉXITO, LA CANCIÓN "MI MÚSICA ES TU VOZ" ESTÁ 4 SEMANAS CONSECUTIVAS EN PRIMER LUGAR. MI PREGUNTA ES LA SIGUIENTE: ¿CUÁL HA SIDO TU EXPERIENCIA DESÚÉS DE LA ACADEMIA, Y CÓMO TE HA TRATADO TU PÚBLICO?. ¿NO SE TE HAN SUBIDO LOS HUMOS CON TANTA FAMA?

Object

1239Object22/06/2002 10:16:21

HOla Wapo!!Sé sincero.¿Has hecho alguna vez pirateria???Venga, mojate, que antes no estabas forrao de dinero como ahora!!! Mariapi (Zaragoza)

Object

1240Object22/06/2002 10:18:01

¿Cómo te sienta la fama?¿Hechas de menos tu intimidad?O te gusta estar to el dia rodeado de fans histéricas como nosotras? Mariapi (Zaragoza)

Object

1241Object22/06/2002 10:18:53

¿Imaginabas tener tanto éxito? Quiero decirte que soy una fans peruana, y te admiro muchísimo a ti y a Bisbal.

Object

1242Object22/06/2002 10:18:58

esto ya keda un poco atras pero, ¿xq crees q el jurado siempre te nominaba? ¿crees q tienes mas apoyo del publico por ser "el guapete"? besos. toda españa te kiere

Object

1243Object22/06/2002 10:23:36

lo primero de todo felicitarte porque eres un artistazo de los pies AaLa cabeza y mi pregunta es la siquiente: ¿TIENES PROGRAMADO ALGUN CONCIERTO O FIRMA DE DISCO EN NAVARRA(PAMPLONA? GRACIAS Y UN BESAZO GUAPETON

Object

1244Object22/06/2002 10:24:40

Busta soy Laura y soy de Madrid. me gustas mucho y siempre te he apoyado. Mi pregunta es que si vendrias a darme una sorpresa y que si te gusta Gisela? Muchos besos. Laura.

Object

1245Object22/06/2002 10:27:49

Hola Bustamante! ¿en los conciertos que coincides con Vero como lo hareis,primero uno canta todas sus canciones y despues el otro, una cancion cada uno o como?Gracias,te quiero mucho.MELANI

Object

1246Object22/06/2002 10:28:07

Hola davis estoy encantadisima de poder hablar contigo,ya que solo coincidi una vez en el foro contigo.Solo decirte que eres el mejor y que tu disco es buenisimo.Una pregunta al final vienes a oviedo en tu gira o no??

Object

1247Object22/06/2002 10:28:21

HOLA BUSTA QUE TAL¡¡¡ SOLO QUERIA DECIRTE QUE ERES EL MEJOR DE TODOS CON DIFERENCIA POR QUE AUN ESTANDO EN LA FAMA RECUERDAS MUCHO Y SIEMPRE A TU SAN MIGUEL DE LA BARQUERA. SIGUE ASI QUE ERES EL MEJOR¡¡¡¡ VIVA SAN MIGUEL DE LA BARQUERA¡¡¡¡¡¡¡¡¡ UN SALUDO: ZEROS

Object

1248Object22/06/2002 10:29:36

Hola Bustamante, ¿ Que tal llevas la fama ? ¿ Que se siente al vender tantos discos ? De parte de Maria. Cabezon de la Sal ( Cantabria )

Object

1249Object22/06/2002 10:29:42

vas a ir a valdepeñas (ciudad real) a firmar autografos? contestame en mi correo electronico: laurachacon@menta.net

Object

1250Object22/06/2002 10:30:18

Cuentanos ¿q es lo mas original q han hecho por ti, tus fans durante esta gira de OT? Alguna anecdota , curiosidad divertida, etccc Te queremos y porfavor conectate mas con tu foro, te echamos de menos.(Ganador64 y elesmisuperman)

Object

1251Object22/06/2002 10:30:39

David eres el mejor,me llamo veronica y te escribo desde oviedo,solo decirte que tu disco es impresionante,todas las canciones son buenas sigue asi eres el mejor.¿Cual setria el sueño mas grande de tu vida? yo lo tengo clarisimo,conocerte a ti.un beso

Object

1252Object22/06/2002 10:31:20

¿kien es tu jugador favorito del r.madrid?

Object

1253Object22/06/2002 10:31:21

¿Qué se siente la primera vez que se sube a un escenario, la gente te conoce y grita tu nombre? ¿De alguna de las fans tuyas que se te han acercado guardas algún recuerdo especial de alguna? ¿Crees que te podrías enamorar de una de ellas?

Object

1254Object22/06/2002 10:32:48

si supiera que tienes una fan en cartagena, Colombia, que tiene ese mismo sueño tuyo, pero no tiene las puertas para poderlo realizar, ese sueño que desde pequeña a permanecido en ella,la ayudarias, o por lo menos la llamarias y le dijeras algun consejo? si tu respuesta es que si entonces aqui te djeo mis datos, mi nombre karime chaljub, telefono 6652962, cartagena, bolivar en el pais de colombia

Object

1255Object22/06/2002 10:35:03

Hola Bustamante, ¿ Que tal estas llevando la fama ? ¿ Que se siente al ser de los discos mas vendidos en España ? Saludos. Maria. Cabezon de la Sal ( Cantabria )

Object

1256Object22/06/2002 10:35:29

Hola Busta, me llamo adalberto y escribo de Tenerife. Para mi tienes muy buena voz y eres un artistazo, pero no tienes miedo de que tantas ventas de discos sean devidas a operación triunfo y que con un segundo disco al haber puesto el liston tan alto no podais llegar. un abrazo, mandame un saludo please.

Object

1257Object22/06/2002 10:35:34

Hola David, soy una muy muy muy fan tuya que daria lo que fuera por verte, tocarte y conocerte y no tengo la oportunidad ni la ocasion. Tu eres mi vida y sin ti me es imposible vivir. Soy de Barcelona ( La Llagosta ) y me llamo Raquel Velez Garcia y tengo 12 años. Mi pregunta es la siguiente: ¿VAS A VENIR A FIRMAR DISCOS AL CORTE INGLES DE LA DIAGONAL DE BARCELONA? Lo pregunto porque es la unica oportunidad que tengo para realizar mi sueño y seguir con mi vida porque ahora mismo no puedo vivir sin verte... Espero que me contestes porque me arias la niña mas feliz del mundo entero para siempre. Cuenta siempre con mi apoyo. Te lo he dado, te lo sigo dando y te lo dare. Espero que me entiendas. TE QUIERO. ¡¡¡ERES UN ARTISTA CON TODAS LAS PALABRAS!!! Vas a llegar muy muy lejos. BESOS

Object

1258Object22/06/2002 10:36:08

¿en agosto vas a estar en San Vicente?esque yo voy a ir solo para ver donde vives y si puedo conocer a tus padres y hermanos.TE QUIERO MUCHO COMO LA TRUCHA AL TRUCHO

Object

1259Object22/06/2002 10:37:05

ola,soy cris de un pueblo de ciudad real,desde q empezaste en operacion triunfo me as gustado.algu8na vez te imaginaste q llegarias tan alto en el mundo de la musica?

Object

1260Object22/06/2002 10:38:07

¿porque eres tan guapo?

Object

1261Object22/06/2002 10:38:12

Hola David, soy una muy muy muy fan tuya que daria lo que fuera por verte, tocarte y conocerte y no tengo la oportunidad ni la ocasion. Tu eres mi vida y sin ti me es imposible vivir. Soy de Barcelona ( La Llagosta ) y me llamo Raquel Velez Garcia y tengo 12 años. Mi pregunta es la siguiente: ¿VAS A VENIR A FIRMAR DISCOS AL CORTE INGLES DE LA DIAGONAL DE BARCELONA? Lo pregunto porque es la unica oportunidad que tengo para realizar mi sueño y seguir con mi vida porque ahora mismo no puedo vivir sin verte... Espero que me contestes porque me arias la niña mas feliz del mundo entero para siempre. Cuenta siempre con mi apoyo. Te lo he dado, te lo sigo dando y te lo dare. Espero que me entiendas. TE QUIERO. ¡¡¡ERES UN ARTISTA CON TODAS LAS PALABRAS!!! Vas a llegar muy muy lejos. BESOS Te quiero.

Object

1262Object22/06/2002 10:38:56

Hola David, soy una muy muy muy fan tuya que daria lo que fuera por verte, tocarte y conocerte y no tengo la oportunidad ni la ocasion. Tu eres mi vida y sin ti me es imposible vivir. Soy de Barcelona ( La Llagosta ) y me llamo Raquel Velez Garcia y tengo 12 años. Mi pregunta es la siguiente: ¿PUEDO CONOCERTE PERSONALMENTE? ¿DONDE VAS A ESTAR ESTE VERANO APARTE DE LOS CONCIERTOS? Lo pregunto porque es la unica oportunidad que tengo para realizar mi sueño y seguir con mi vida porque ahora mismo no puedo vivir sin verte... Espero que me contestes porque me arias la niña mas feliz del mundo entero para siempre. Cuenta siempre con mi apoyo. Te lo he dado, te lo sigo dando y te lo dare. Espero que me entiendas. TE QUIERO. ¡¡¡ERES UN ARTISTA CON TODAS LAS PALABRAS!!! Vas a llegar muy muy lejos. BESOS

Object

1263Object22/06/2002 10:39:35

hola Busta soy una malagueña que esta loca por ti,quiero tu disco pero aun no me dejan comprarmelo si me lo puedes mandar te lo agradeceria,eres el mejor,animos y pa lante que vas a arrasar,adios Busta te quiero.De Lidia pa Busta que es el mejor y siempre lo sera

Object

1264Object22/06/2002 10:41:44

¿Hay alguna previsión de fechas para el lanzamiento del segundo disco? ¿Será antes de navidad?

Object

1265Object22/06/2002 10:43:43

hola wapissssssssimo una fiel seguidora cantabra . ¿cuando te pasaras por tu tierra para firmar discos? estaria encantada de conocerte eres lo mejor de operacion triunfo!!!!!!! ya es hora que se vea la raza cantabra!!!!!

Object

1266Object22/06/2002 10:45:23

hola wapiiiiiiiisssssssssiiimmmmmooooo ¿¿¿¿cuando te vas a pasar por cantabria tu querida tierra para firmar discos???? una fiel seguidora canntabra -laurina-

Object

1267Object22/06/2002 10:46:00

Hola, soy Ainhoa, la hermana de tu fan nº 1, Sandra, de León.Me gustaría saber si vas a venir a firmar discos a León.

Object

1268Object22/06/2002 10:46:13

soy una de las chicas que se quedó sin que le firmaras en el disco el sábado en las PAlmas ¿recuerdas? Por qué no fuiste a firmar un día antes de que actuaras o otro día que luego no ibas a actuar? ¿No sabías la cantidad d gente q iba a ir? Yo dé q tu no tienes la culpa, pero bueno... Muchísima suerte, ¿sabes en que sitio de las palmas vendrás con Vero el próximo 27 de junio? Un besazo mi Bustamante y mucha suerte, Te kiero, YESENIA,las palmas

Object

1269Object22/06/2002 10:49:09

sabes a que parte de las palmas vendrás el 27 de julio? Vendrás a firmar + autógrafos? Yo fui una de las que se quedaron sin él, en el corte ingles de las palmas. Un besito Bustamante, te kiero mucho, Axya, las palmas

Object

1270Object22/06/2002 10:50:13

ola busta! soy jessi, una gran fan tuya que va mucho a tu piso de bcn para verte! pero me han dicho que todos vosotros ya os estais cambiando el piso...es cierto? tu eres uno d ellos? los pisos siguen en bcn? porfavor contesta. tkm

Object

1271Object22/06/2002 10:51:03

Hola mi vida!Me llamo Raquel Velez Garcia y soy de La Llagosta de Barcelona. Mi pregunta es: ¿Te acuerdas en el concierto del Palau Sant Jordi el dia 09.04.02 que una de las veces te grite eres el mejor, guapo, te quiero y te tocaste el corazon y me señalaste y que me tiraste un beso? Bueno pos si te acuerdas esa era yo. Soy una muy muy muy fan tuya que daria lo que fuera por verte, tocarte y conocerte y no tengo la oportunidad ni la ocasion. Tu eres mi vida y sin ti me es imposible vivir. Lo pregunto porque es la unica oportunidad que tengo para realizar mi sueño y seguir con mi vida porque ahora mismo no puedo vivir sin verte... Espero que me contestes porque me arias la niña mas feliz del mundo entero para siempre. Cuenta siempre con mi apoyo. Te lo he dado, te lo sigo dando y te lo dare. Espero que me entiendas. TE QUIERO. ¡¡¡ERES UN ARTISTA CON TODAS LAS PALABRAS!!! Vas a llegar muy muy lejos. BESOS

Object

1272Object22/06/2002 10:53:00

Hola guapìsimo!!! me gustaria saber cuando es la firma de discos en barcelona!!! Y una cosa, aqui como k¡que no haces ningun concierto???besazo de cristina-bcn

Object

1273Object22/06/2002 10:53:07

hola david . me gustaría preguntarte qué tal es tu relación con vero y natalia , y en el caso de vero , si te hizo ilusión , alivio , etc.. o qué impresión tubiste cuando supiste que compartirías gira con ella . Muchos Besos xxCRISTINAxx

Object

1274Object22/06/2002 10:53:16

bustamante, soy muy, muy fan tuya, tengo todo lo que esta a la venta sobre ti y todavia quiero mas, y por eso me gustaria que realizaras un concierto en valladolid, ya que e visto donde vas a actuar i no se encontraba esta bella ciudad. Un besazo y hasta pronto. Cristina Gurruchaga, Valladolid

Object

1275Object22/06/2002 10:54:10

tu paso por operacion triunfo fue un exito, ¿como vez tu futuro? es pero que tengas mucho exito y saludos desde el Ecuador suerte en tu carrera y sigue adelante que todos te quieren

Object

1276Object22/06/2002 10:54:36

Siendo tan cantabro como tu eres ¿Como aras para sobrevivir en barcelona todoel tiempo sin apenas poder visitar tu tierra? Cristina Cantabria

Object

1277Object22/06/2002 10:54:45

Hola Bustamante soy de Puerto Rico y quiero saber cuando bienes para hacer promocion aca en la isla besos TE AMO Jamilette

Object

1278Object22/06/2002 10:54:48

David¿a que partes de valencia vas a ir,y qué días?x cierto kiero que sepas q eres muy guapo y que tu disco es lo mejor un beso te quiero y que sepas q x ti e llorado a mares y que incluso a veces e dejado de comer.mi tel el 660212841 feliz verano

Object

1279Object22/06/2002 10:54:49

¿Sabes lo que se llega a sentir por una persona como tu? Muchas de nosotras te queremos y dariamos la vida por ti...no se como te lo tomas pero me puedes decir si nosotras/os significamos para ti mas que "fans"? Me llamo Raquel Velez Garcia, soy una niña de 12 años que mi vida eres tu y que si no llego a verte me voy a morir. Soy de Barcelona (la llagosta) y aun no e tenido la oportunidad de tocarte. Te vi en concierto pero... TE QUIERO MUCHO Y TENGO QUE TOCARTE.

Object

1280Object22/06/2002 10:56:03

¿COMO TE SIENTES AL SALIR A LA CALLE Y QUE TODOS TE COÑOZCAN Y TE PIDAN AUTOGRAFOS? ROCIO DE GRANADA GGGGGGGUUUUUUUUAAAAAAAAPPPPPOOOOOOO!!!!

Object

1281Object22/06/2002 10:56:10

¿Porque eres tan perfecto?

Object

1282Object22/06/2002 10:56:16

¿Sabes lo que se llega a sentir por una persona como tu? Muchas de nosotras te queremos y dariamos la vida por ti...no se como te lo tomas pero me puedes decir si nosotras/os significamos para ti mas que "fans"? Me llamo Raquel Velez Garcia y tengo 12 años. Soy de Barcelona, especialmente de La Llagosta. Con una pregunta no puedo expresar todo lo que siento por ti. Si tengo la oportunidad de verte... ya te lo dire. TE QUIERO ,ARTISTA!!!

Object

1283Object22/06/2002 10:58:32

Hola David, ¿Te gusta el cine? ¿Cuál es tu película favorita? Un beso.

Object

1284Object22/06/2002 10:59:52

Hola David, ¿Cuál es tu libro preferido? Eres estupendo, un beso.

Object

1285Object22/06/2002 11:00:46

hola david!!¿como te sentiste al saber que eras unos de los favoritos de operacion triunfo? un beso ( Dácil, las palmas de gran canaria).

Object

1286Object22/06/2002 11:04:03

Bustamante la carta que te mande para tu cumpleaños fue una de pegatinas de terciopelo ¿la leiste?muchiiiiisimos besos Lorena.

Object

1287Object22/06/2002 11:08:04

soy una chica DE MANRESA, me llamo jessica y queria saber y haras alguna gira por Cataluña ya q para mi eres el mejor. besos

Object

1288Object22/06/2002 11:08:33

POR QUE NO VIENEN DE GIRA AL ECUADOR??? AQUI SON MUY EXITOSOS Y TENGO MUCHAS GANAS DE CONOCERLOS.

Object

1289Object22/06/2002 11:08:49

¿Que es eso que tienes que encandila a tu gente?

Object

1290Object22/06/2002 11:09:33

¿Quieres a tu foro? Nosotros a ti muchisimo! Mari.

Object

1291Object22/06/2002 11:10:18

david bustamante soi acmirador tuYO mellamo alfredo gabarri jimenez megustaria conocirte soy de aviles

Object

1292Object22/06/2002 11:10:29

Hola mi vida!Me llamo Raquel Velez Garcia y soy de La Llagosta de Barcelona. Mi pregunta es: ¿Te acuerdas en el concierto del Palau Sant Jordi el dia 09.04.02 que una de las veces te grite eres el mejor, guapo, te quiero y te tocaste el corazon y me señalaste y que me tiraste un beso? Bueno pos si te acuerdas esa era yo. Soy una muy muy muy fan tuya que daria lo que fuera por verte, tocarte y conocerte y no tengo la oportunidad ni la ocasion. Tu eres mi vida y sin ti me es imposible vivir. Lo pregunto porque es la unica oportunidad que tengo para realizar mi sueño y seguir con mi vida porque ahora mismo no puedo vivir sin verte... Espero que me contestes porque me arias la niña mas feliz del mundo entero para siempre. Cuenta siempre con mi apoyo. Te lo he dado, te lo sigo dando y te lo dare. Espero que me entiendas. TE QUIERO. ¡¡¡ERES UN ARTISTA CON TODAS LAS PALABRAS!!! Vas a llegar muy muy lejos. BESOS

Object

1293Object22/06/2002 11:14:34

David soy de Ecuador y por aca son re famosos y muy queridos..... Te gustaria venir a dar un concierto aca? que piensas de SudAmerica te gustaria conocer estos paises tan hermosos en donde la gente te quiere mucho, besos guapo!!! TE QUEREMOS MUCHO!!! CAMILA ECUADOR!!

Object

1294Object22/06/2002 11:17:55

HOLA GUAPO!!! FELICIDADES SOS EL MEJOR, SI TE PROPONDRIAN VENIR AL ECUADOR TE GUSTARIA CONOCERLO, ACA LA GENTE TE RE AMA, SOS UN IDOLO Y NOS ENCATARIA TENERTE A TI JUNTO A TUS EX COMPAÑEROS DE OPERACION TRIUNFO POR ACA, SON TODOS UNOS IDOLOS Y NOS ENCATARIA TENERLOS POR ACA?? SUERTE GUAPO!! SOS EL MEJOR

Object

1295Object22/06/2002 11:19:02

Soy de Mallorca, me gustaria saber si en la gira va a haber pases Vips. Gracias

Object

1296Object22/06/2002 11:19:10

ola guapisimo,te ha gustao como te ha salido tu disco y como se vende? yo lo tengo desde el primer dia y me encanta,sobre todo duda de amor. me encantaria q m mandaras 1 beso para mi(carmen alonso),y un abrazo si no pido muxo. ¿vendras a sevilla a firmar discos?espero q si para q m firmes el mio. bueno m despido:muxos besos y abrazos d 1 d tus muxas fans.T KIERO

Object

1297Object22/06/2002 11:19:45

Hola busta soy de palma de Mallorca, soy la que tuvo pase vip aqui en mallorca, Bueno me gustaria saber, que si solo vais a actur una vez en Mallorca?

Object

1298Object22/06/2002 11:19:47

PUEDES MANTENER UNA INTERVIUW SIN MENCIONAR EL AGRADECIMIENTO A TUS PADRES ???? HO ES QUE NO TE PUEDES DESGANCHAR DE ELLOS?????????

Object

1299Object22/06/2002 11:20:11

Bustamante!!! Te gusta Mallorca???

Object

1300Object22/06/2002 11:20:55

Hola mi vida!Me llamo Raquel Velez Garcia y soy de La Llagosta de Barcelona. Mi pregunta es: ¿Te acuerdas en el concierto del Palau Sant Jordi el dia 09.04.02 que una de las veces te grite eres el mejor, guapo, te quiero y te tocaste el corazon y me señalaste y que me tiraste un beso? Bueno pos si te acuerdas esa era yo. Soy una muy muy muy fan tuya que daria lo que fuera por verte, tocarte y conocerte y no tengo la oportunidad ni la ocasion. Tu eres mi vida y sin ti me es imposible vivir. Lo pregunto porque es la unica oportunidad que tengo para realizar mi sueño y seguir con mi vida porque ahora mismo no puedo vivir sin verte... Espero que me contestes porque me arias la niña mas feliz del mundo entero para siempre. Cuenta siempre con mi apoyo. Te lo he dado, te lo sigo dando y te lo dare. Espero que me entiendas. TE QUIERO. ¡¡¡ERES UN ARTISTA CON TODAS LAS PALABRAS!!! Vas a llegar muy muy lejos. BESOS

Object

1301Object22/06/2002 11:22:59

Bueno Soy de Venezuela, y siempre te e apoyado ya que, me puedo identificar contigo como persona. Queria Preguntar si vas a venir A mi PAIS (VEMEZUELA) AlGUNA VEZ. Porque mi SUEños es poder estar en un concierto de algunos de OT? Y que pueda aprecir toda esa magia y ganas que llevas por dentro y llevan tus compañeros de la ACADEMIA...

Object

1302Object22/06/2002 11:26:33

que te dan pa comer, para ser tan sexy? un beso Mataró

Object

1303Object22/06/2002 11:28:18

en la cancion de Cantabria en el estribillo"cantabria la tierra que me vio nace crecer y enamorarme cantabria el trigo dices? si es asi a que viene el trigo en Cantabria o es por la rima no es por vulgaridad si te lo tomas asi es una duda que no se me quita y para solucionarla tendra que solucionarmela el que la canta que en este caso eres tu.UN BESO MUY GRANDE LAURA "SANTANDER" AH!cuando vendras al palacio de la madalena?

Object

1304Object22/06/2002 11:28:52

si aun tiene una brujita q le regale junto a la cadena. g.c. (omayra)

Object

1305Object22/06/2002 11:32:19

Mi nombre es Kamira y soy de la República de Panamá soy tu fan 1. Quiero saber tu e-mail. El mío es muriel2000@mixmail.com Por favor cúmpleme éste deseo.

Object

1306Object22/06/2002 11:32:25

cuando vandras a santander a actuar para todos nosotros?te digo para todos porque cuando has venido a el palacio de festivales o mi madre y mi tia que es lo mas provable que se hayan confundido,digeron que para mallores de 18 años y eso es injusto yo tengo 14 años y estoy ahorando para cuando vengas al palacio de la magdalena y encima no me dejan irte a ver al palcio de festivales bueno te dejo un saludo y un besazo laura SANTANDER

Object

1307Object22/06/2002 11:32:39

¿ Cuando vendras a Mexico ? ¿ Que emocion te dio cuando te dijeron que eres el finalistas para interpretar un tema en Eurovision ?

Object

1308Object22/06/2002 11:33:25

hola wapisimooooo ¿cuando vengas a algeciras en tu gira en solitario vas a firmar discos a alguna hora del dia? si vas a firmar discos dimelo y por favor dime donde si lo saves

Object

1309Object22/06/2002 11:34:37

hola David.Lo 1º que queria decirte es que has sido, eres y seras el mejor cantante de la historia.He estado en varios programas a los que has ido y me encanta tu naturalidad y sinceridad. ¿siempre has sido asi? por favor no cambies nunca. 1 beso de tu fan nº1.(Irene,15,madrid)

Object

1310Object22/06/2002 11:38:29

Ahora mismo estas hecho un gran artista,pero ¿crees que sin haber estado en operación triunfo,hubieras conseguido esta fama?Yo pienso que si,no cambies porque eres el mejor.1beso de una gran fan tuya.soraya.

Object

1311Object22/06/2002 11:39:01

podrias llegar a sentir amor muy fuerte por alguna fan tuya en especial?

Object

1312Object22/06/2002 11:39:17

Mi nombre es Melina y te apoyamos todos los latinoamericanos desde Londres que te hemos apoyado desde el casting, Mi pregunta es ahora que ya eres un gran cantante, que metas y que suenos tienes para el futuro que no hayas relizado aun?. Estas dispuesto a representar a Espana y dejar al mundo saber que los Espanoles pueden hacer buena musica tanto en Espanol como tambien en Ingles? Espero escuchar tu proximo album en ingles, suerte campeon y que Dios te bendiga. Melina Caceres

Object

1313Object22/06/2002 11:41:48

vas a venir a firmar discos en madrid?

Object

1314Object22/06/2002 11:44:03

vas a ir de concierto a zaragoza??? que fecha???

Object

1315Object22/06/2002 11:44:25

Hola. En tu gira estarás acompañado por Verónica, pero,¿cuando vais a venir a Valencia?¿Habrá firma de discos en Valencia? Un beso, enhorabuena. Gracias, Maite.

Object

1316Object22/06/2002 11:45:04

hara gira por america

Object

1317Object22/06/2002 11:46:02

hola necesito saber si en su recorrido de gira estaran en guayaquil. A david estas reguapo escribeme a mujermaravilla1974@latinmail.com

Object

1318Object22/06/2002 11:47:18

Eres fuapísimo, y me admira tu originalidad,estoy segura de que triunfarás. ¿Te molesta hablar sobre tu vida personal? Angela, Ecuador

Object

1319Object22/06/2002 11:48:02

hola David!!soy Cris de Madrid,bueno primero preguntarte que si sabes ya la fecha de tu concierto en Aranjuez ya que es el unico que haces en la comunidad.Ahora quiero darte las gracias por ser como eres y por haber resucitado muchas ilusiones en las que habia perdido la fe y decirte que toda mi familia y yo somos unos seguidores tuyos de primera.Cada vez que sales en la tele nos plantamos los 4 en el sofa a verte.tengo una carta escrita para ti,te la puedo mandar?te quiero como nunca he querido a nadie.de lo mas hondo de mi corazon,millones de besos para el cantabro mas especial.muuuuua.te quiere:Cris de Madrid.

Object

1320Object22/06/2002 11:48:08

Hola wapeton! Somos una fan tuya y otra de Nuria,somos de Granada,queremos saber si en tu gira con Vero vendras por Granada y si ves que has evolucionado en los 4 meses que has estado en la academia.Un besazo enorme de SuSi y PiLaR!

Object

1321Object22/06/2002 11:52:27

¿vas ha hacer la gira tu solo o con tu amigo Alex?seria mejor con Alex pero si la haces tu solo no pasa nada porque eres el mejor.un besazo muy grande guapetón.raquel.valencia

Object

1322Object22/06/2002 11:52:53

Busta, soy una gran fan tuya. Dime, ¿por que has hecho la gira de conciertos con Vero y no solo como muchos de tus compañeros? uN BESO, PARA EL MAS WAPO DL MUNDO

Object

1323Object22/06/2002 11:55:37

¿Te gustaría quedar con una chica linarense? Es que tengo ganas de quedar contigo.

Object

1324Object22/06/2002 11:59:04

Que has sacado, o aprendido en todo este tiempo dentro de la academia te a servido mucho?besos,adeu.

Object

1325Object22/06/2002 11:59:37

¿Con qué participante te gustaría grabar alguna canción?

Object

1326Object23/06/2002 12:00:22

Busta, t kiero, eres el mejor!! si tuvieras q elegir las 4 personas d la academia con las q hayas tenido mejor relacion, a kienes elijirias?

Object

1327Object23/06/2002 12:06:36

Hola Bustamante,soy Rocio y me gustaria saber cuando vienes a Sevilla. Tengo 8 años y me encanta como eres y lo bien que cantas, tu disco me lo compró mama nada mas salir porque sabe que eres un cielo.

Object

1328Object23/06/2002 12:06:47

Hola Busta eres un chico corriente,eres un chico normal,pero no se lo q tienes q no te puedo olvidar.Mi me pregunta es¿Q x q no vienes de gira a Tenerife o a firmar disco con las ganas q tengo q de vengas y no vienes?¿Y q te parecio mi la isla?Bueno esas son mi preguntas mas nada q sepas q eres EL MEJOR!!!!Y q siempre lo seras te kiero besos.De tu fan 1º Melisa.WAPO!!!!

Object

1329Object23/06/2002 12:07:06

¿busta vas a pasar en concierto por malaga?¿vendrás con vero? espero q si eres el mejor. juan luis

Object

1330Object23/06/2002 12:11:18

¿VAS A VENIR A FIRMAR DISCOS AL CORTE INGLES DE LA DIAGONAL DE BARCELONA? Ven pronto,te quiero,te espero.Raquel Velez de La Llagosta (BCN)

Object

1331Object23/06/2002 12:14:13

Hola David!!! Soy de Venezuela y soy una de las tantas fans numero y que hay en mi pais. Te digo que aqui en Venezuela has tenido un exito ROTUNDO. Hace pocos dias lei en un periodico que conociste a Natasha Moll y me alegre mucho. Ahora mi pregunta es como reaccionas ante la respuesta de la gente a nivel internacional? y si hay esperanzas de venir a Venezuela. T.Q.M. y te admiro

Object

1332Object23/06/2002 12:19:29

Tu que experiencia tenias antes de OT??.¿No crees que es demasiado peligroso estar en la cima tan joven??.Lo siento chaval pero pronostico tu caida no muy tarde.

Object

1333Object23/06/2002 12:20:18

hola david ,me llamo macarena ruiz y tengo 19 años y soy de chile y vi la operacion truinfo por la television,eres una persona muy linda y me encantas y tus canciones tambien espero recibir una respuesta te mando un beso a la distancias y espero que llegues muy lejos y creo que es un hecho . adios david b. espero recibir una respuesta

Object

1334Object23/06/2002 12:24:41

Cuando la vida se pone tan de cara es que a la vuelta de la esquina te espera un problema,y muy gordo.¿Opinas lo mismo o tu exceso de alegria te impide ver el futuro sin problemas?

Object

1335Object23/06/2002 12:28:14

¿No te parece excesivo el fenomeno de OT?.¿No crees que la sociedad esta demasiada enferma para que tu y tus colegas seais referencia para la juventud?.

Object

1336Object23/06/2002 12:28:46

David supongo que estaras orgulloso de tu exito tienes un disco fabuloso y me encanta en tus giras ahora conoceras a tus verdaderas fans¿que arece ir de gira con una persona tan estupenda como Vero?¿que preferirias ir solo o con otros compañeros?¿que es lo que mas echas de menos de la academia?un beso y enhorabuena por tu trabajo

Object

1337Object23/06/2002 12:42:49

El romance con Gisela, era solamente una trama para el concurso o era de verdad?

Object

1338Object23/06/2002 12:44:29

¿vas a venir a la argentina?

Object

1339Object23/06/2002 12:46:02

hola soy mariana de jujuy argentina y me gustaria saber si es que vas a venir aqui a mi pais , seria mi sueño

Object

1340Object23/06/2002 12:47:43

¿Como crees tú, que se puede combatir la piratería, si los precios elevados de los discos originales son el principal factor que ocasiona que esta tenga gran demanda entre los consumidores, ya que en países como el mío (México), con una economía inferior a la de un país Europeo o de primer mundo, resulta para la mayoría de los habitantes un gasto considerable el comprar un CD legitimo?

Object

1341Object23/06/2002 12:51:19

piensas ser famoso en todo el mundo? bueno eso de hecho pero es que soy peruana y aca no llegan los discos de ustedes y yo no los puedo comprar. deberian de mandar unos cuantos aqui suerte en tu crrera artistica espero que sigas triunfando. respunde aqui porfavor mafe177@hotmail.com

Object

1342Object23/06/2002 12:51:20

soy mexicano, y para mi sería un gusto muy grande el poder estar en una presentación en publico donde tu seas el protagonista, mas sin embargo, realmente lo veo muy dificil, ¿ crees poder visitar el interior de la republica mexicana (en este caso Xalapa, veracruz) en tu proxima visita a México?

Object

1343Object23/06/2002 01:01:17

sfgsdfgsdfg

Object

1344Object23/06/2002 01:02:44

¿¿Te podrías llegar a enamorar de una fans??

Object

1345Object23/06/2002 01:04:03

busta cuando vienes a republica dominicana me encantaria porderte ver personalmente eres muy guapo, ademas de que cantas muy bien. me encanta tu forma de ser tan sencible. te quiero nelly

Object

1346Object23/06/2002 01:04:30

hola David, ¿cuál sería tu día perfecto con una chica especial para ti?

Object

1347Object23/06/2002 01:05:37

busta cuando vienes a republica dominicana?

Object

1348Object23/06/2002 01:05:54

HOLA BUSTA, SOY DE TORTOSA Y ME LLAMO CRISTINA, QUE SEPAS QUE ERES EL MEJOR, TE QUIERO. EN WWW.DAVIDBUSTAMANTE.COM, VAS AL CHAT? ES QUE POR ALLÍ MUCHAS VEZES DICEN QUE TÚ ENTRAS EN EL CHAT ANÓNIMAMENTE. EL DÍA 18 DE JULIO YO ESTARÉ EN TU CONCIERTO DE LA AMPOLLA EN PRIMERA FILA... ME MUERO POR TOCARTE Y POR QUE ME FIRMES UN AUTÓGRAFO. ADIÓS TIO BUENO, MAZIZO, BOMBÓN.

Object

1349Object23/06/2002 01:11:13

Por qué te has cambiado tanto el pelo. Me encantaba como lo tenias cuando entrastes a O.T. Muy suelto, algo mas corto y sin esas cosas que te pones. Cómo lo prefieres tu?

Object

1350Object23/06/2002 01:19:32

hola mi nombre es macarena tengo 19 años y soy de chile mi pregunta es si piensas hacer una gira afuera de españa como chile ? y si lo hacen espero que me avises a mi correo makitaruiz@esmas.com.me encantaria que me escribieras suerte . ciaooooo

Object

1351Object23/06/2002 01:23:35

soy una chica de 23 años que nunca había tenido un ídolo, pero tu me ha parecido diferente a los demás artistas ¿Quçe crees que me ha podido llamar la atención de ti?

Object

1352Object23/06/2002 01:25:08

Saludos desde ecuador para david, y quiero que sepas que en mi pais tienes tambien un grupo de fans que te admiran y te aman, es especial yo paulina (ecuador)

Object

1353Object23/06/2002 01:34:49

ola busta tengo 5 años y me gustaria saber cuando cantaras en madrid otra vez.dale un besito a gisela

Object

1354Object23/06/2002 01:35:06

Hola!! soy de Venezuela y queria decirte que ya tengo tu disco, aqui ya se venden en las tiendas. Queria preguntarte si tienes entre tus planes está venir a mi pais. Por favor no te olvides de visitarnos que aqui se les quiere muchisimos. Besos Lorena

Object

1355Object23/06/2002 01:44:02

HOla David me podrias contar un poquito como ha cambiado tu vida luego del paso de la Academia? Te ves con los demas chicos de la Academia? Cuando Vienes a Latinoamerica?

Object

1356Object23/06/2002 01:49:56

¿ustedes han planeado venir a ecuador o a america? que por aca nos morimos por verlos y a una amiga dice que eres el mas guapo dicen miles amigas

Object

1357Object23/06/2002 01:52:32

Busta cariño, haces que te siga porque tienes una voz especial y un corazón puro,todo esto nos ha conquistado y sé que llegarás lejos, y tus verdaderas fans lucharemos por ti. como dices en tu canción. Me gustaría saber ¿cómo se ha decidido quién organiza las pareja para las giras,y también los lugares y fechas en los que actúas? Me encantaría verte actuar con Gisela en la gira porque vuestras voces juntas me llegan al corazón. Tu disco es genial, pero "y si tengo que morir" me ha enamorado. Tengo que verte y que me firmes el disco porque nunca me ha dado tan fuerte por ningún cantante en la vida, así que por algo digo lo de; que si eres un superman, que nunca tengas dudas de amor, que respiro el aire que me das,me encanta Cantabría(voy este verano en agosto..)por un beso yo me muero, porque además de ti, no hay más...Besos de tu incondicional.Elena de Jerez de la Frontera.

Object

1358Object23/06/2002 01:52:39

TU ERES NOVIO DE GISELA

Object

1359Object23/06/2002 01:53:01

cual de las chicas de ot te parece mas guapa

Object

1360Object23/06/2002 01:53:13

¿TU ERES NOVIO DE GISELA

Object

1361Object23/06/2002 01:54:29

Hola David ¿tienes planes de hacer una gira por sudamerica?si la haces me alegro por ti enormemente pero, porfavor que te traigan prontito de vuelta, te necesitamos.Elena.Tu incondicional

Object

1362Object23/06/2002 02:06:04

hola david antes que nada felicitarte por el exito que estas teniendo con tu disco y queria preguntarte ¿ cuando vas a venir a promocionar tu disco a mexico ? gracias y suerte en todo lo que hagas. Mony de mexico

Object

1363Object23/06/2002 02:09:00

¿Que significa para tí haber alcanzado el éxito primero con tu participación en el programa y luego con tu cd convirtiendote en uno de los favoritos de operacion triunfo ? sigue así karina-madrid

Object

1364Object23/06/2002 02:14:55

quiero saber la dirección de correo electrónico de Bustamante para tener comunicación con el, asi como la fecha de su gira a mexico, soy mexicana y me encuentro en la republica dominicana y quiero ir a mexico exclusivamente a verlo por favor la decirme la fecha por favor...

Object

1365Object23/06/2002 02:19:20

En realidad no quiero hacer una pregunta sino solamente hacerle llegar a David, desde Uruguay, mis saludos y felicitaciones por el éxito obtenido. Realmente se lo merece. Le deseo mucha suerte en el futuro. Un gran abrazo desde aqui. Carolina.

Object

1366Object23/06/2002 02:25:26

Hola Busta! Soy una fan tuya, y espero verte en Roda de Bara y en l'Ampolla(tarragona), me gustaría preguntarte (si es posible dos cosas): 1-saber cuando son las fiestas de tu pueblo Sant Vicente de la Barquera. 2- Se comenta que se ha anulado el concierto del 6 de julio en Roda de Barà (tarragona), ¿eso es cierto?Es que la gente opina pero ¿quien mejor que tu lo puede saber=, hay mucha gente a la que le gustaria que lo contaras. Venga Campeón, eres muy bueno como persona y como cantante. Te mereces todo el éxito que estás teniendo y que tendrás, eso no lo dudes. Un besote y un fuerte abrazo. Te quiere silvia:silb

Object

1367Object23/06/2002 02:29:09

Obviamente la carrera de cantante es un tanto complicada. Estás preparado para trabajar con las situaciones difíciles que a veces tienen que vivir los cantantes? Cómo es tu relación con Dios, si alguna?

Object

1368Object23/06/2002 02:30:44

Cuando haga la gira por latinoamérica ¿A que países va a visitar?

Object

1369Object23/06/2002 02:31:38

Guapo, ¿Cómo es que no coincides cantando con Gisela?a tus fans nos haría mas ilusión...hablalo con quien sea.Nunca imaginabamos que cantarias con Vero.Besos.ECB

Object

1370Object23/06/2002 02:32:15

Cuando haga si gira por Latinoamérica ¿A qué países va a visitar?

Object

1371Object23/06/2002 02:33:33

¿No os habeis planteado cantar los tres David?Civera,Bisbal y por supuesto tú?Podría estar muy bien.un beso.Sonia.

Object

1372Object23/06/2002 02:37:17

David, ¿por que no cantais Manu, Bisbal y tu,juntos?sois los mejores chicos y sobre todo tu.Abrazos.HQJ

Object

1373Object23/06/2002 02:44:02

una pregunta : Hola david, a ti te molasta que PACO UMBRAL en el programa de de Cronicas Marcianas diga esas cosas como : "BUSTAMANTE SE LA JUEGA EN EL ANDAMIO " ???

Object

1374Object23/06/2002 02:53:53

SI WESTLIFE TE PIDIERA QUE FUERAS SU TELONERO LO SERIAS Y POR QUE

Object

1375Object23/06/2002 02:57:10

VENDRAS A VENEZUEL ALGUNA VEZ

Object

1376Object23/06/2002 02:58:08

¿Te has enamorado alguna vez de verdad?

Object

1377Object23/06/2002 03:00:23

Hola!Somos dos amigas con un mismo destino,ese destino eres tu. El dia 5 vamos a venir a verte a Palamós y nos gustaria mucho poder conocerte, como lo podemos hacer? Un besito muy fuerte de B i N

Object

1378Object23/06/2002 03:06:19

¿ESTA EN SUS PLANES EL VENIR A PUERTO RICO ?

Object

1379Object23/06/2002 03:08:32

¿SERA POSIBLE SU VISITA A LA ISLA DE PUERTO RICO? AQUI LO ADMIRAMOS MUCHO Y SU CD SE AGOTA EN CUANTO LLEGA A LAS TIENDAS DE DISCOS. EL MARTES PROXIMO LLEGARA OTRA CANTIDAD DE SU CD E IRE TEMPRANO A COMPRAR EL MIO. LE DESEO EXITO, LUZ TRISTANI

Object

1380Object23/06/2002 03:12:55

podrias venir~ las fiestas de puente castro leon el dia 29 de este mes

Object

1381Object23/06/2002 03:24:57

YO QUISIERA SABER CUANTO TE IMPORTA LA ACADEMIA CON TODOS SUS CONCURSANTES

Object

1382Object23/06/2002 03:26:09

hola lindo, ¿sabes porqué el mar es salado?, porque tú le robaste toda la dulzura:)Mis preguntas serían ¿Cuál crees que sea el rasgo que más te defina y qué o quién es el gran amor de tu vida?,con todo mi cariño:Medalit de Lima, Perú

Object

1383Object23/06/2002 03:29:19

hola lindo, ¿sabes porqué el mar es salado? porque tu le robaste toda la dulzura:)mis preguntas serían ¿cuál crees que sea el rasgo que más te defina y qué o quién es el gran amor de tu vida? Con todo mi cariño: Medalit de Lima, Perú

Object

1384Object23/06/2002 03:33:35

¿cuál crees que sea el rasgo que más te defina y qué o quién es el gran amor de tu vida? Medalit de Lima, Perú

Object

1385Object23/06/2002 03:47:37

hola david, soy de mexico, y soy una de tus tantas fans, pero estoy muy confundida, y quiero que me digas si andas con gisela? te amoooooooooo, tu enamorada desde mexicoo

Object

1386Object23/06/2002 04:03:16

busta solo queria decirte q eres demasiado bello y que aqui en venezuela eres muy popular tu y los chicos de operacion triunfo! pero tu eres especial demasiado bello!!! queria saber si tienes pensado venir a venezuela para un concierto porq de verdad te necesito ver! bueno era eso y decirte q te adoro demasiado y eres lo mas bello q hay en todo españa y el mundo!! te quiere tu fan n° 1 de venezuela!! mariana!!!!

Object

1387Object23/06/2002 04:05:40

Alguna vez tendras pensado visitar a venezuela o algun pais de sudamerica donde tienes muchisimos fans????

Object

1388Object23/06/2002 04:06:58

hola david, felicidades por tu paso por la academia y por tu carrera como solista. mi pregunta son 2 la primera cuamdo vienes a mexico y llega tu disco a mexico y la segunda es si yo como mexicano puedo hacer casting para operacion trinufo españa, espero tener respuesta a estas preguntas y decirte que en mexico d.f. tienes un fan con ganas de conocerte y escuchar tu musica gracias por conpartir tu feliciada y tus sueños, espero pronto hacer los mios, desde mexico alguien con quien puedes contar y que te apoya 100% en tu carrera tu fan numer 1 israel dosta torres.. israeltorres78@hotmail.com por favor mandales muchos saludos a todos tus compañeros y diles que siempre boy a pollarlos en sus carreras como solistas y esperando con ancias su llegada a mexico muchas felicides espero me escriban bye..

Object

1389Object23/06/2002 04:15:25

Busta en Venezuela ya tienes una fan que te adora, cuando haras tu gira por latinoamerica para que vengas a mi pais. Te quiere mucho Carolina

Object

1390Object23/06/2002 04:16:44

Bueno, te quiero desear suerte en tu carrera por que cantas fabuloso y te queria preguntar que si algun dia vendras por aca por que tienes muchas y muchos fans. cuidate mucho y sigue asi besos yamilka

Object

1391Object23/06/2002 04:25:43

Hola Busta, te escribo desde Venezuela para preguntarte si tienes alguna gira por latinoamérica (incluido mi pais) dentro de poco o más o menos para cuando sería. Te cuento que tu disco ha llegado aquí (que yo sepa a una tienda en especial) y voló, ese mismo dia se acabaron. Un beso y suerte.

Object

1392Object23/06/2002 04:27:28

Mi pregunta se refiere a sí eres conciente de la importancia que tuvo Operación Triunfo para tí a nivel mundial ya que yo soy uruguaya y aquí tú y todos los concursantes tuvieron gran tracendecia. Muchas gracias y mucha suerte. Mariana Araújo(Uruguay)

Object

1393Object23/06/2002 04:29:50

David Soy de México y me gustaria saber , si algun dia vas a venir, te admiro muchisimo, nunca me perdi operacion triunfo y tu disco es el mejor eres un gran artista. con mucho cariño roxy

Object

1394Object23/06/2002 04:34:10

busta quisiera saber si tienes planeado venir a venezuela a hacer un concierto?? porq aqui eres muy famoso y te queremos ver!

Object

1395Object23/06/2002 04:34:33

Después de toda la acogida que has tenido en tu país España, tienes pensado llegar a Latinoamerica con tu nuevo disco? Que por cierto esta buenisimo. Schery Lange (Panamá)

Object

1396Object23/06/2002 04:39:07

busta queria decirte que eres el mejor y mas bello del mundo!!y queria saber con cual cancion de tu disco te identificas mas y porque? te adoro tu fan n°1 de venezuela. INES.

Object

1397Object23/06/2002 04:47:59

Hola Busta. Te felicito a ti y a tus compañeros por todo lo que han logrado. Yo soy una chica de Colombia,los veo desde que empezaron en Octubre. Me gustaria saber si vendrías a Colombia alguna vez, y tambien saber Cuando es que vienes a Mexico?. Chao y mucha Suerte en la gira del verano, y suerte a todos tus amigos de la academía. (Margarita Marin, Medellín.Colombia).

Object

1398Object23/06/2002 04:51:14

Hola Wapoo! qué tal? yo en realidad soy fan de Bisbalin pero no puedo eviitar sentirme encantada por tu bella voz y la forma en que interpretas esas baladillas, WOW!!, tengo dos preguntitas: cuándo vendrás a las "Américas" joe, t esperamos con ansias!? y cómo te sientes con tanta demanda por parte de gente de este lado?? Mucha SUERTE!! Oriana Rosales Caracas, Venezuela.. (saludos a Vane que anda organizando tu delegación por aqui, un beso) EXITO guapo

Object

1399Object23/06/2002 04:53:09

Hola busta. Soy de Colombia, me gustaría saber cuando vienes a America, y que paises piensas visitar?

Object

1400Object23/06/2002 04:53:34

busta primero q todo quiero decirte q te has convertido en una inspiracion para mi en la vida te admiro demasiado y te adoro!quisiera saber¿si pudieras cambiar algo en el mundo que seria?y ¿como te sientes de lograr tanta fama en tan poco tiempo no hes un cambio muy fuerte? te quiere alejandra venezuela.

Object

1401Object23/06/2002 04:55:05

Hola Busta. Si escribieras una cancion, a quien se la dedicarías y porque?

Object

1402Object23/06/2002 04:55:32

Quiero saber si hay posibilidad de poder escribirte y obviamente me contestes? A qué correo? Ligilda Beato.- De: República Dominicana e-mail: ligildab@hotmail.com GRACIAS!!!!!

Object

1403Object23/06/2002 04:56:05

Hola como estás, quiero que sepas que cantas increíble, esta es mi pregunta ¿Algún día piensas en venir a Costa Rica?.

Object

1404Object23/06/2002 04:57:08

Hola David. ¿Si compusieras una canción y te dijeran que la puedes incluir en el disco de una artista, a cual artista le darías tu canción y porque? (Margarita Marin. Colombia)

Object

1405Object23/06/2002 04:58:40

Podrías contar alguna anécdota que hayas pasado mientras estuviste en la academia y que nunca olvidarás??? Un besote de una fan en la República Dominicana.

Object

1406Object23/06/2002 04:59:55

En estos momentos, ¿Qué te hace falta para ser completamente feliz? Anabel Mencía, una fan de República Dominicana

Object

1407Object23/06/2002 05:00:34

hola busta!!!quisiera saber cuales son tus influencias musicales?te quiere mariana venezuela

Object

1408Object23/06/2002 05:01:40

Queridisimo Busta. En Republica Dominicana estamos esperando ver la entre- ga de tu disco de diamante. Que pasa con esto???? Te lo ganaste porque eres fantastico y una persona de un carisma tremendo. Contesta mi pregunta O>KEY?

Object

1409Object23/06/2002 05:02:47

¿Que se siente saber que en tan pocos meses te ganaste el cariño de tanta gente, no solo en España sino también en países de América Latina? Aquí en República Dominicana tienes muchísimas fans, incluyendome a mi. Besos, Anabel Mencía.República Dominicana

Object

1410Object23/06/2002 05:05:45

DAVID BUSTAMANTE, ME PARECES FENOMENAL, ERES EL MEJOR DE TODOS, TE ADMIRO MUCHO, ME GUSTA TU FORMA DE SER, TE ENVIO ESTE MENSAJE DESDE ECUADOR QUISIERA SABER COMO TE SIENTES EN HABER ALCANZADO EL TRIUNFO, Y LA ADMIRACION DE MUCHAS PERSONAS. TE ESCRIBE MARGARITA VIVIANA CHACHA LLANO

Object

1411Object23/06/2002 05:06:21

Por tu simpatía, por lo guapo que estas y por tu forma de ser te haz robado el corazón de miles de mujeres, no solo en España, sino también en América Latina.¿Cómo tiene que ser una mujer para que robe el corazón de David Bustamante?. Anabel Mencía,República Dominicana.

Object

1412Object23/06/2002 05:09:51

Si te encuentras en un concurso, y llegas a las semifinales, pero te enteras que uno de tus amigos, que también está en las semifinal, le diagnostican que está con cáncer, y que le quedan algunos días de vida. Y una de tus opciones es dejarle ganar, elegirías esa opción. También te mando un besote, y espero que tus sueños se hagan realidad. Att. Dannylu.

Object

1413Object23/06/2002 05:11:16

Bustamante te escribo desde de Puerto rico y soy cubana me encantaria saber cuando vienes a Puerto rico???// gracias dianne

Object

1414Object23/06/2002 05:11:18

david mas que una pregunta es una consejo pon todo tu amor en el esenario y que dios te bendiga y espero pues que seas el ganador muchassuerte bye

Object

1415Object23/06/2002 05:18:03

Hola, GUAPO!!!! Mi pregunta es: ¿qué es lo que más aprecias o amas en tu vida? de Jamie Irizarry (Saludos y muchos besos desde Puerto Rico. Te amamos mucho,campeon!)

Object

1416Object23/06/2002 05:18:05

Soy de Venezuela y eres mi idolo quisiera saber: ¿Tienes pensado hacer una gira por America del sur? gracias mucho exito...

Object

1417Object23/06/2002 05:21:50

Hola Busta soy Geovanna de Ecuador y aca recien se esta transmitiendo el programa el cual ya falta poco para que elijan a los finalistas.Lo que quería saber es si piensas en un futuro realizar giras internacionales como por ejemplo a Ecuador, porque de verdad todos nosotros te adoramos y pues si pudieras venir seria FABULOSO. Besos tu admiradora latina.

Object

1418Object23/06/2002 05:28:42

¿Qué fue lo mejor de haber pertenecido a la 1era. edición de Operación Triunfo?Un besote desde República Dominicana, Anabel Mencía

Object

1419Object23/06/2002 05:30:08

Hola Davidcito de mi vida me llamo Geovanna soy de Ecuador te mando un besote y quisiera saber de todos los artistas que fueron a la academia cual te llamo mas la tención y porque.

Object

1420Object23/06/2002 05:30:25

Hola David, primero que nada te mando un beso enorme desde la República Dominicana, quisiera saber que fue lo que mas y lo que menos te gustó del tiempo que estuviste en la academia. Anabel Mencía

Object

1421Object23/06/2002 05:31:46

Hola Busta, primero que nada mil felicidades por ese talento que tienes!!! Mi pregunta se relaciona con el inicio de Operación Triunfo en México, próximamente... a mi me encantaría correr la suerte de vivir el sueño que tu y los demás chicos han vivido y cumplido, por lo que me he inscrito a las audiciones... ¿Cómo fueron tus audiciones y qué consejos me podrías dar para cuando realice la mía? y ¿cuándo vienes a México, hay algo planeado pronto?, que muchos vimos por canal internacional OT y seguimos sus pasos de cerca y nos encantaría verlos, o poder comprar su CD!!! Muchos besos y sigue pa'lante!!! Jessica Bustamante Garciavilla (probablemente familia, mi padre es madrileño y su familia de santander!!!) México, D.F. xuxecps@hotmail.com

Object

1422Object23/06/2002 05:56:55

Tienes planeado venir a América latina a promocionar tu Cd??, aquí se esta vendiendo muy bien!!! Anabel Mencía , República Dominicana

Object

1423Object23/06/2002 05:58:29

HOLA BUSTA, SOMOS DOS FANS TUYAS DESDE PUERTO RICO. VAMOS A ESPAÑA DEL 6 DE JULIO AL 5 DE AGOSTO...¿DONDE NOS VEMOS? MUCHA SUERTE Y MUCHO EXITO Y ESPERAMOS QUE PRONTO VENGAN A AMERICA. ESTAN SONANDO MUCHO EN LA RADIO EN PUERTO RICO. IVONNE Y MARIANNA

Object

1424Object23/06/2002 06:02:17

Alguna vez se te ha pasado por la mente el visitar el Ecuador.... y si lo haces me encantaria que llegaras a la ciudad de Cuenca y me des una foto autografiada ..... muchos besos tu fan Jhaneth Cordero

Object

1425Object23/06/2002 06:09:30

de tan guapo que estas, si tuvieras que escoger entre las artistas mas famosas para tener un romance en serio, cual escogerias?

Object

1426Object23/06/2002 06:09:41

tu visita por america es muy esperada, sobre todo en venezuela el cual esta formando un club de fans, nos podrias decir cuando tienes pensado venir a america y si vienes a venezuela cuando?? y como te sientes que ahora no solo eres famoso en españa sino tambien en todo america, un saludo muy grande. Alejandro

Object

1427Object23/06/2002 06:13:57

HOLA DAVID BUSTAMANTE, TE ESCRIBO DESDE MONTEVIDEO, URUGUAY POR QUÉ QUISIERA SABER SI EN TUS PLANES DE FUTURO ¿HAS PENSADO HACER ALGUNA GIRA POR AMÉRICA LATINA? SI PUEDE SER POSIBLE QUE NOS REGALES TU PRESENCIA Y TU VOZ. HE SEGUIDO OT A TRAVÉS DE TVE INTERNACIONAL. CARIÑOS PARA TÍ, DRUMI. yazmin_yazmin@hotmail.com

Object

1428Object23/06/2002 06:21:04

HOLA DAVID, CREO QUE TU DISCO ES COMPLETÍSIMO Y QUE EXPLOTA PERFECTAMENTE TU GAMA DE REGISTROS ARTÍSTICOS Y VOCALES,PERO ¿QUE TE SIENTES MÁS, CANTANTE MELODICO O DE CANCIÓN LATINA?,¿CON CUÁL DE ELLAS DISFRUTAS MÁS EN EL ESCENARIO?.UN FUERTE ABRAZO, TE SEGUIRE SIEMPRE......

Object

1429Object23/06/2002 06:26:54

PERSONALMENTE CREO QUE TU DISCO ES EXCEPCIONAL, SIMPLEMENTE ME GUSTARIA SABER QUÉ SE SIENTE DELANTE DE 20000 PERSONAS EXPRESANDO CANCIONES TAN MARAVILLOSAS COMO "ADEMAS DE TI","CUANDO HACEMOS EL AMOR","BESOS" O "CANTABRIA".UN FORTÍSIMO ABRAZO, TE SEGUIRÉ SIEMPRE.......

Object

1430Object23/06/2002 06:29:01

¿que ocurre con Gisella??????

Object

1431Object23/06/2002 06:37:34

Todos tenemos un sueño cuando niños; veo que el tuyo ya se ha realizado..Mi pregunta es: ¿ Sientes que te falta algo para ser completamente feliz?

Object

1432Object23/06/2002 06:40:41

BUSTAMANTE... DESDE ECUADOR MUCHAS FELICIDADES TU HAS DEMOSTRADO QUE LOS SUEÑOS SE HACEN REALIDAD Y COMO DECIMOS ACA .... SI SE PUEDE..... ALCANZAR LO QUE SE LUCHA... SERA QUE PODEMOS SOÑAR CON CONTAR LA PRESENCIA DE LOS FINALISTAS Y PORSUPUESTO PRINCIPALMENTE DE TI EN ALGUNA GIRA POR ECUADOR????? CREES PODER AYUDAR PARA QUE ESE SUEÑO SE HAGA REALIDAD?... ESPERO ME PUEDAS RESPONDER... marle001@hotmail.com ..... UN BESO...

Object

1433Object23/06/2002 06:44:43

Hola.. En primer lugar quiero felicitarte por el disco que es fantastico y preguntarte cuando vendras a Venezuela a promocionar el disco. Aqui tienes muchas fans.. Ok. Un Abrazo y no cambies. Ely. Caracas-Venezuela

Object

1434Object23/06/2002 06:48:10

Bustamante estoy hablandote desde republica dominicana, quiero felicitarte, te admiro y adoro. Quiero saber: ¿ Cual es tu idea de un mundo mejor?

Object

1435Object23/06/2002 06:52:12

David ¿Cuales son tus metas, es decir que tan lejos quieres llegar?, eres un campeon, te adoro. Farah, Rep. Dominicana.

Object

1436Object23/06/2002 07:53:57

¿Qué opinas de las críticas hechas hacia vosotros por algunos artistas?¿Serán por envidia o porque están en decadencia(María Jiménez)?

Object

1437Object23/06/2002 07:55:33

¿No crees que para que la música viva(el lema del pasado día de protesta)ha de llegar al máximo de bolsillos con precios asequibles(y no los actuales)?

Object

1438Object23/06/2002 08:14:44

es posible y cuando que visite los paises de america latina?

Object

1439Object23/06/2002 08:26:58

¿Harás una gira internacional?

Object

1440Object23/06/2002 08:30:36

Si haces una gira internacional:¿Vendrás a Uruguay o aunque sea a Argentina?(Uruguay es un país situado en América del sur al lado de Argentina), mira que en Uruguay tienes muchas fans y si vienes ire a verte seré la primera en comprar una entrada.

Object

1441Object23/06/2002 08:32:07

¿Sabías que tienes muchas fans en Uruguay?,(es un país de América del sur situado al lado de Argentina)

Object

1442Object23/06/2002 08:32:59

¿Cómo te sientes en este momento de tu vida?

Object

1443Object23/06/2002 08:33:58

¿Has estado muy ocupado ultimamente con todas las actuaciones que has tenio?

Object

1444Object23/06/2002 09:24:34

Hola david! Solo te escribo para desearte lo mejor del mundo porque tu te lo mereces todo por ser la persona mas maravillosa de este mundo. Ojala estes muchisimos años haciendonos disfrutar con tu voz. Un besazo enorme, Lara.

Object

1445Object23/06/2002 09:28:26

Hola David! Cuando vas a Sanvicente puedes seguir haciendo tu vida de antes o la fama apenas de te deja salir de tu casa?Animo porque eres Grande y una persona maravillosa. TQM, Lara

Object

1446Object23/06/2002 09:50:59

¿Porqué no actuas en Barcelona o cerca de esta?

Object

1447Object23/06/2002 09:59:08

BUSTAMANTE CUANDO BIENES AL PAIS VASCO A CANTAR

Object

1448Object23/06/2002 10:12:25

Recuerdas el garito de Astillero? y la caida con la moto?eres el mejor.De tu amiga L.de Astillero

Object

1449Object23/06/2002 10:22:51

Hola Davis Bustamante, soy unas de tus numerosas fans numero 1. Megustaria realizarte la pregunta siguiente:¿cual es el sueño que aun te gustaria cumplir? Tambien quiero saber cual va a ser tu proximo singel. Una pista podia ser:"El aire que me dad" o "No soy un superman". porque tiunfaran este verano.un beso guapeton. Artista!!!!!!!!!!

Object

1450Object23/06/2002 10:29:25

¿Busta ye gustava q te yamaran "el benjamín?" como opinión de chica a mi no me disgustava pero hijo que tampoco eres tan pekeño.Besos Rosa (Valencia)

Object

1451Object23/06/2002 10:31:02

¿Es cieto que vas a hacer la gira con Verónica, tu compañera de Operación Triunfo? ¿Os habeus puesto vosotros de acuerdo para las parejas o los cantantes no habeis dicho nada?

Object

1452Object23/06/2002 10:37:28

Hola al cántabro + guapo.Desde que entraste a la academia me gustó tu forma de ser, al verte cantar supe llegarías lejos y no me perdía ni un día O.T. para verte y espero verte muy pronto en Murcia. ¿Has pensado alguna vez en componer? Creo que se te dará bien con los piropos que lanzas.

Object

1453Object23/06/2002 10:47:50

hola busti echas demenos a los compañeros . el dia que vengas a gerona cantas con la vero ho cantais por separado? esque lo quiero saber por que yo voy ha hir te quiero DAVID BUSTAMANTE DISCO DE DIAMANTE Y SIGE PA LANTE. UNA FAN pati

Object

1454Object23/06/2002 11:06:18

Nos puedes adelantar como va a ser tu gira de verano con Verónica? Beseos, Nuria (Santa Pola)

Object

1455Object23/06/2002 11:06:48

ya tu dices que no estas salindo con gisel pero si lo dices no pasr nada quisela tambien es una de las mejores. ¿Es verdad que estas con gisela?

Object

1456Object23/06/2002 11:07:09

Como es un dia en la vida de Bustamante? Nuria y Johnny.

Object

1457Object23/06/2002 11:09:05

Busta vas a ir a Lucena

Object

1458Object23/06/2002 11:13:07

hola busta te acuerda de hace unos cuantos domingos atra que vinistes con 2 de tus compañeras y que cierta cajera de un restaurante os regalo unas rosas me encontre con tres personas maravillosas te tengo que hacer una pregunta sabes que hoy en dia hay muchos problemas con las drogas.y no se habla de los muchos efectos secundarios que traen uno de ellos es la esquizofrenia sabes algo acerca de ella por que no haceis un concierto y recaudais fondos para ella mi hermano la padece y es muy triste que una persona de 19 años que este en la flor de la vida se le escape la vida y lo ves como cada dia la enfermedad se apodera de ella y ati solo te queda ey te sa impotencia solo por un rato de diversion y por la ignorancia de que efectos secundarios trae y es un tema tabu solo quiero decirte que tuve la oportunidad de conoceros posdata recuerda CUALQUIERA QUE SEA LA PREGUNTA EL AMOR ES LA RESPUESTA Y QUE ES MARAVILLOSO SER IMPORTANTE PERO ES MAS IMPORTANTE SER MARAVILLOSO busta un beso te acuerdas de el glop pues tengo los cd tuyo

Object

1459Object23/06/2002 11:13:08

¿Cómo te imaginas dentro de dos años?

Object

1460Object23/06/2002 11:13:54

¿cómo te imaginas dentro de dos años?

Object

1461Object23/06/2002 11:14:22

Hola artista, cuando vendrás a Barcelona para firmar discos? Que sepas que eres el mejor, llegarás muy lejos y te deseo toda la suerte del mundo! 1 besazo de una fan que te quiere mucho!

Object

1462Object23/06/2002 11:17:30

Hola guapisimo!!. Que es lo que emnos y mas te gustó de la estancia en la Academia? 1 besazo y que sepas que eres el mejor!

Object

1463Object23/06/2002 11:18:22

¿Cual es el concierto que mas te ha gustado?(En donde)

Object

1464Object23/06/2002 11:18:59

Busta soy un fan tuyo quisiera hacerte una pregunta me puedes decir que es lo que sientes cuando ves a tantas personas debajo de ti y tu cantando

Object

1465Object23/06/2002 11:19:11

Si pudieras cambiar algo de este mundo , ¿que cambiarias? 1 besazo y que sepas que eres el mejor. Cris,bcn.

Object

1466Object23/06/2002 11:19:23

¿Qué tipo de música te gusta?

Object

1467Object23/06/2002 11:30:33

OYE BUSTA TE HA GUSTA ESTAR EN CANARIAS ?¿ Y OTRA COSA TE DIO PENA VER LA GENTE LLORANDO POR LO DE LAS VALLAS¿?? Y ESPERO QUE VENGAS OTRA VEZ A FIRMAR A LAS PALMAS QUE AQUI TE QUIEREN MUCHO .BESOS NORMA.

Object

1468Object23/06/2002 11:31:25

como llevan tus padre lo de tener un hijo famoso?? y tan guapo?desde Palma de mallorca. no puedo ir a tu concierto pq nadie viene conmigo.me conformare con escucharte en el disco.muxos besos.leticia

Object

1469Object23/06/2002 11:34:28

hola yo queria saber si ¿con gisela tienes algun roze o solo es como duo artístico? un besazo ana

Object

1470Object23/06/2002 11:42:56

Hola me llamo Romina, sé que es tu primer disco y te será difícil elegir una canción de tu disco, pero ¿cuál es la que más te gusta o tu preferida?*Un beso desde Las Palmas*

Object

1471Object23/06/2002 11:46:43

En tu gira no aparece Barcelona ni alrrededores, ¿no vas ha venir por aquí? Mucha gente espera que si.

Object

1472Object23/06/2002 11:49:26

as suvido algunavez a un yate?

Object

1473Object23/06/2002 11:50:27

POR QUE TE LLAMAVAN TITIN?

Object

1474Object23/06/2002 11:50:28

Hola Busta!! Soy de Valencia y me gustaria saber si vas a venir a firmar discos y la fecha. Gracias por todo. Muchos besos wapetón.

Object

1475Object23/06/2002 11:52:50

con quien vas a cantar en los conciertos??vas a pasar por madrid??

Object

1476Object23/06/2002 11:53:00

con quien vas a cantar en los conciertos??vas a pasar por madrid??bss mai

Object

1477Object23/06/2002 11:53:01

David cariño, soy Mercè de Tarragona me gustaria saber si la relacion con gisela es verdad, me refieroa si sois novios. AS mi me encanta la pareja q haceis, pero pk no podeis ser felizes¿?, y a la gente q le importa, contesta cielo, besos de la k te kiere mucho, muas!!

Object

1478Object23/06/2002 11:58:27

¿crees que cuando pase el boom de operacion triunfo se iran olvidando la gente de vosotros o en cambio seguira vuestro exito a pesar de haber acabado el programa?

Object

1479Object23/06/2002 11:59:37

que tal te esta sentando el triunfo de tu nuevo trabajo en solitario? MªAntonia

Object

1480Object23/06/2002 12:03:45

Hola David. Me gusta mucho tu disco y se que has realizdo el sueño de tu vida, pero me gustaria saber que otro sueño te gustaria realizar? Un besito. Laia, Girona.

Object

1481Object23/06/2002 12:05:11

Quisiera saber porque no has robado el corazon de la manera que nos los has robado?Eres super especial para tus fans y porque siempre pase lo que pase, estaremos a tu lado!!! Un beso y nunca cambies!

Object

1482Object23/06/2002 12:11:38

Apa Bustamante!!despues del peazo de exito q has tenido,¿tienes pensado hacer un nuevo disco? ¿incluiràs temas en ingles? Un besote mu grande de Janire.Donostia.

Object

1483Object23/06/2002 12:12:29

Hola David bustamante, soy Operarosa.¿Qué es lo que tienes en esa maravillosa garganta, que enloquece a cualquiera con esa gran voz que tienes?, Te deseo muchísima suerte en la vida y Palante. Adios un Beso, Rosa Maria de Córdoba.

Object

1484Object23/06/2002 12:12:59

QUE TE PASA POR LA CABEZ CUANDO VES EL CARIÑO QUE TE TIENE LA GENTE,¿ES REAL TODO ESE AGRADECIMIENTO Y ESA FELICIDAD O EMPIEZAS A ESTAR AGOBIADO POR LA FAMA Y TE GUSTARIA QUE NO TE PARASEN POR LA CALLE?

Object

1485Object23/06/2002 12:14:04

Hola Busta!En tu album tienes un repertorio bastante variado de canciones, melodicas, movidas...pero, ¿con cual de ellas te identificas más? ¿cual es tu preferida?, aunque todas son geniales y te aseguro que puedes estar orgulloso del maravilloso trabajo que has hecho, porque escuchar tu disco es todo un placer. Titina que te quiere. Muchos besazos.

Object

1486Object23/06/2002 12:16:16

¿Que tal llevas la fama? y ¿Que tal con tu disco?

Object

1487Object23/06/2002 12:16:36

¿NO CREES QUE NO ESTAN DEL TODO CLAROS LOS DATOS SOBRE TUS VENTAS? A QUE CREES QUE PUEDE DEBERSE?

Object

1488Object23/06/2002 12:17:19

Busta, ahora que eres una persona famosa y con dinero, ¿sabrás decir NO, algunas cosas que te ofrzcan?, y me refiero a cualquier cosa, tyá que eres muy joven. Espero que terodees de personas que te quieran. un beso. likeone.

Object

1489Object23/06/2002 12:19:06

HOLA DAVID,ES UNA PREGUNTA UN POCO PERSONAL,TIENES TIEMPO AHORA CON TODO ESTE BOOM PARA UNA PAREJA,O PREFIERES ESPERAR A QUE PASE UN POCO LA FIEBRE?¿SON SOLO RUMORES LO QUE CIRCULA SOBRE TI Y GISELA O HAY ALGO MAS?Y POR ULTIMO,COMO SERIA TU MUJER IDEAL,TANTO POR DENTRO COMO POR FUERA?

Object

1490Object23/06/2002 12:19:16

David, ¿cuántos discos llevas ya vendidos?Eres el mejor, tu disco es fantástico y nos alegras la vida a todas tus fans con sólo una sonrisa.TE QUIERO MUCHO. DE LAURA.

Object

1491Object23/06/2002 12:19:38

David, después de todo el triunfo que tienes y ese éxito llamado Bustamante con un merecidísimo diamante: ¿cómo te sientes con todo el apoyo que te estamos dando tu foro? te queremos, David. Blanca Gallego, Valencia.

Object

1492Object23/06/2002 12:21:57

bUSTA, ¿VENDRÁS ESTE VERANO A GRANADA? POR FAVOR VEN, LO ESTAMOS DESEANDO.GRACIAS POR HACERME LA PERSONA MÁS FELIZ DEL MUNDO DESDE QUE APARECISTE EN LA ACADEMIA.1 BESO, LAURA.

Object

1493Object23/06/2002 12:22:39

que te ha parecido este sueño? eres el mejor te quiero mucho.te apoyo desde cadiz.q te vaya bien todo.un besazo de laura

Object

1494Object23/06/2002 12:25:23

Apa Bustamante!! ¿cuando vas a ir a promocionar tu disco a America? ¿tienes pensau ir a algun otro paìs a promocionar? Un besazo mu grande d Janire.Donostia.

Object

1495Object23/06/2002 12:26:21

¿Cuantos discos lleva vendidos?

Object

1496Object23/06/2002 12:27:30

HOLA BUSTA SOY SUSANA Y TENGO 21 AÑOS, ME GUSTARIA SABER SI HARAS UNA FIRMA DE DISCOS EN SABADELL EN EL CORTE INGLES O POR AQUI PORQUE ME ENCANTARIA IR A VERTE Y TENER UN AUTOGRAFO TUYO YA QUE TE HE SEGUIDO A MUCHAS PARTES PERO NO HE PODIDO NI SIQUIERA ACERCARME, GRACIAS Y SIGUE ASI ERES GENIAL. BESITOS

Object

1497Object23/06/2002 12:29:14

Apa Bustamante!! Queria preguntarte por tu tatuaje; ¿a que edad te lo hiziste? ¿te dolio mucho? ¿porquè decidiste hacerte un dragon y no otro dibujo? De janire un besazo mu grande para el mejor!!Donostia.

Object

1498Object23/06/2002 12:30:25

HOLA DAVID SOY DE SABADELL Y ME SIENTO BASTANTE MAL PORQUE HE VISTO TU GIRA Y NO HACES NINGUN CONCIERTO POR AQUI, NO VIENES A TERRASSA NI BARCELONA, NI SABADELL... ASI QUE VOY A TENER QUE DESPLAZARME MAS PARA PODER VERTE, QUE ES LO QUE HA PASADO?

Object

1499Object23/06/2002 12:33:05

HOLA TITIN, ESPERO QUE ESTES MUY BIEN AUNQUE NO LO DUDO, ERES GENIAL Y ESPERO QUE NO CAMBIES NUNCA.. EL DIA 11 DE OCTUBRE ES MI CUMPLE HAGO 22 AÑOS Y BUENO VI TU GIRA Y AL PRINCIPIO TENIAS CONCIERTO POR AQUI EN BARCELONA Y AHORA LO HAS CAMBIADO PARA GIRONA, QUE ES LO QUE HA PASADO? TENIA MUCHAS GANAS DE IR ESE DIA TAN ESPECIAL PARA MI A VERTE EN CONCIERTO Y AHORA ME HE QUEDADO SIN NADA, ESPERO RESPUESTA, GRACIAS POR TODO, BESITOSSSSSS UNA FAN QUE TE QUIERE Y NO TE OLVIDA EN NINGUN MOMENTO, CHAO.

Object

1500Object23/06/2002 12:35:39

HOLA Q TAL ESTAS? ESTOY VIENDO LA REPETICIÓN DE BUSTAMANTE Y AMIGOS.ME PREGUNTO SI HABRÍA ALGUNA MANERA DE PODER CONOCERTE E INTENTAR SER TU AMIGA?

Object

1501Object23/06/2002 12:36:22

david, ¿cres que estar en la discografica vale-music, te a beneficiado o por el contrario,?yá que tienes en la misma compañia a bisbal, y te hqa sacado del primer puesto en la lista de ventas.¿cres que esta compañia tiene preferencia por él?eres el mejor. un besote. likeone.

Object

1502Object23/06/2002 12:38:20

busta.¿porque no te dejan decir que tienes pareja?¿por cuestion de marketin?tus fans te queremos con o sin pareja. me encanta tu disco,. likeone.

Object

1503Object23/06/2002 12:38:33

Busta soy una de tus fans me gustaria que me digeras tu direccion, por favor te doy mi numero de telefono me gustaria que me llamaras si puedes y quieres llamame o que me escribieras una carta te doy mi direccion Arancha Lopez Segura Barrio Nuevo N 15 02440 Molinicos probincia Albacete por favor escribeme o dame tu telefono te recibire con mucha alegria.Eres el mejor de todos lo tienes todo eres guapo,cariñoso,simpatico,y cantas estupendamente bueno me despido con un fuerte besazo GUAPETON me gustaria que un dia vinieras a visitarme.ADIOS DE TU FANS ARANCHA.TE QUIERO ADIOS GUAPETON. ESPERO QUE TE HAYA GUSTADO MI CARTA BUSTA. HASTA LA PROCXIMA VEZ.

Object

1504Object23/06/2002 12:38:53

cual sera tu proximo single ''nara''

Object

1505Object23/06/2002 12:39:02

HOLA GUAPETON. ME GUSTARIA SABER EN REALIDAD CUANTOS DISCOS HAS VENDIDO? UN BESAZO DE UNA CHICA DE JAÉN.

Object

1506Object23/06/2002 12:40:19

busta.¿que crees que pasara cuando comience 0T-2?sabes que hay muchas personas que no lo vamos a ver, ppues consideramos que ganador solo hay uno.un beso. likeone.

Object

1507Object23/06/2002 12:42:33

busta¿que piensas cuando estás solo en los hoteles?son muchas horas, sin familia sin amigos¿sin novia?, no hay veces que hecharias a correr, y lo dejarias todo. un beso. likeone.

Object

1508Object23/06/2002 12:45:21

¿a que años empezaste a cantar?me se todas tus canciones,y me encanta cantar,mi sueño es ser cantante como tú.tengo 13 años y siempre estoy cantando tus canciones,eres mi idolo!!!adios.

Object

1509Object23/06/2002 12:47:28

Hola soy Alba. Me gustaria saber si vendras pos Catalunya pronto!!pfavor knt!una beso a mi chico preferido!sigue asi!!!!!!

Object

1510Object23/06/2002 12:57:17

Hola wapisimo!!!!!! Soy una chika de Barcelona, y me gustaria saber porque no haces ningún concierto aki en Barcelona??? te has olvidado de nosotras????? Un Besazo

Object

1511Object23/06/2002 12:58:06

Busta me gustaria saber cuando empiezas la gira? te sabes ya todas tus canciones? k te parece ir con vero de gira? a mi me encanta, x k sois mis favoritos desde k empezo el programa.Felicidades x las ventas de tu disco! Besos desde Ibiza.ANA.

Object

1512Object23/06/2002 12:59:36

Hola Busta!!!! Soy Eli de BCN, me gustaria saber que es lo mejor que te ha pasado desde que estas dentro de este mundo?. Un MMMMUUUUUAAAAAACCCCCCCCCCC

Object

1513Object23/06/2002 01:00:19

Busta cuantos conciertos haces en solitario? Ves mucho a tus compañeros? Vas a lanzar el disco en America? Besos de tu fan Ana. IBIZA.

Object

1514Object23/06/2002 01:01:07

Hola Busta, yo sólo quería felicitarte por cómo eres, por tu sencillez y todo eso q tienes. Bueno tamíén preguntarte que ¿qué tal llevas esto de que todo el mundo te conozca, que se acerquen a ti continuamente? ¿No te agobia, aunque sea un poquitín? y también, ¿Cuál es la canción del disco

Object

1515Object23/06/2002 01:01:27

hola me gustas mucho como cantante.i me gustaria saber cuando pasas por barcelona por tu gira.Deborah de barcelona.-

Object

1516Object23/06/2002 01:01:57

Crees q. podrias enamorarte de una persona de la calle,de la k nadie sabe nada?como tiene k ser tu pareja?el tatuaje k llevas tiene algun valor sentimental o significa algo???m encantaria irme contigo de farra xq aparte d buena gente,eres una persona muy divertida.te kiere una d esas fans k no son quinceañeas,Xq puedes llevar a todos los publicos.un beso ,guapo.Eider(bilbo)

Object

1517Object23/06/2002 01:02:32

Cual es la canción favorita de tu disco? Yo no te lo podria decir, ¡x k me gustan todas. FELICIDADES! Cual es el disco de tus compañeros k mas te ha impresionado? BESOS Y SUERTE. ANA.

Object

1518Object23/06/2002 01:02:46

Hola!!! Bustamante, quisiera saber que sientes al cantar la cancion dedicada a tu tierra, supongo que es algo dificil de explicar, pero que sientes?

Object

1519Object23/06/2002 01:03:13

si todo sigue hacia delante y sigues con tanto éxito¿dejarias de lado tu vida sentimental con tal de que continuara tu sueño siempre?TQM,blanca

Object

1520Object23/06/2002 01:04:27

que tal te lo pasaste en valencia haciendo las fotas del libro adjunto en tu disco? que te parecio la ciudad? un beso eres el mejor paula de valencia

Object

1521Object23/06/2002 01:04:49

Hola Busta, yo sólo quería felicitarte por cómo eres, por tu sencillez y todo eso q tienes. Bueno tamíén preguntarte que ¿qué tal llevas esto de que todo el mundo te conozca, que se acerquen a ti continuamente? ¿No te agobia, aunque sea un poquitín? y también, ¿Cuál es la canción del disco que más te gusta?, a mi me encanta "dos hombres y un destino", tb "el aire que me das", en general todas están genial. Bueno un besote. Tuxa, Asturias (Asturias siermpre te apoyó mucho, y seguirá haciendolo)

Object

1522Object23/06/2002 01:05:50

cuando entraste en la academia parecia que te gustaba gisela ¿fue asi? sandra

Object

1523Object23/06/2002 01:06:03

¿k tres deseos pedirias ahora mismo?T kierooo,blanka

Object

1524Object23/06/2002 01:06:07

Busta hablais entre vosotros de la venta de los discos? Cuantas ventas llevas? Pronto seguro que llegas al diamante. Suerte! y felicidades por el disco. ANA, IBIZA

Object

1525Object23/06/2002 01:06:25

¿porqué no vas a venir a Zaragoza?

Object

1526Object23/06/2002 01:06:55

por q no vienes a algeciras otra vez??

Object

1527Object23/06/2002 01:07:02

¿si tuvieras que pedirle un favor a algun compañero de la acdemia ? ¿a cual se lo pediria?

Object

1528Object23/06/2002 01:09:04

Busta estan ya confirmados todos los conciertos? Vas a venir a Ibiza? En la revista ponia que venias con Vero y Chenoa es verdad? BESOS Y SUERTE. ANA, IBIZA

Object

1529Object23/06/2002 01:11:20

Hola wuapetón!!!Antes q' nada felicitarte x el maravilloso disco q tienes y q no me canso de escuchar.Mi pregunta es,¿crees que existe la perfección?,pq yo la conocí contigo;o)Besos Ma.Angeles,Valencia

Object

1530Object23/06/2002 01:13:07

¿Has escuchado y te gusta otro tipo de música a parte de cantantes melódicos como Luis Miguel, Cristian y Luis Fonsi?

Object

1531Object23/06/2002 01:14:25

¿Xq le quitaste el puesto a Chenoa en el 3º puesto de la final????

Object

1532Object23/06/2002 01:14:59

¿Te gustaria escribir tus propias canciones?

Object

1533Object23/06/2002 01:15:27

¿¿¿tuviste algun momento en la academia en el kisieras abandonar????si s k si,¿k motivos?un beso d tu fan sevillana k t adora,blank.

Object

1534Object23/06/2002 01:16:20

¿Crees que es muy dificil mantenerse en el mundo de la canción sino se tiene un estilo propio?

Object

1535Object23/06/2002 01:16:24

¿Cuando vas a venir agijon a dar un concierto? Estamos deseando que vengas tenemos ganas de verte.rony

Object

1536Object23/06/2002 01:17:53

HOLA DAVID,ME GUSTARIA SABER SI TU TIENES VOZ Y VOTO A LA HORA DE ELEGIR DONDE ACTUAS O SIMPLEMENTE ERES UN MANDADO,POR CIERTO SI ES ASI MIRA A VER SI PUEDES VENIR MAS A ASTURIAS QUE TE QUEREMOS MUCHO MUCHAS GRACIAS Y UN BESO

Object

1537Object23/06/2002 01:18:05

Con el gran éxito que tu primer disco ¿crees que los mejores productores y compositores desearán trabajar contigo?

Object

1538Object23/06/2002 01:18:29

es dificil preguntarte algo que no te hallan preguntado ya, por eso yo solo quiero decirte que tu disco es buenisimo y que como tu voz tan dulce no hay otra igual y que voy a hacer todo lo posible para ir a algun concierto tuyo aunque mis padres no me dejen.adios guapo de una cordobesa que te adora

Object

1539Object23/06/2002 01:18:52

¿¿qué opinas de la pirateria??tengo k decirte k cada vez k veo a uno con la manta y tu cd,m pongo a chillarle xq no m da la gana de que jueguen con la carrera de mi niño.T KIERO DAVID.blanca

Object

1540Object23/06/2002 01:19:06

David has pensado en experimentar con otro tipo de rítmos (pop,soul,etc), personalmente creo que serías capaz de interpretar cualquier cosa que te propusieras, nunca dejas de sorprenderme con tu voz. Un besuco. MIRIAM de Pamplona (Mi nick MIARGO en tu foro)

Object

1541Object23/06/2002 01:20:10

hola bustamante soy una chica que me gustaria ser cantante ¿como consigues que aunque estes muy muy nervioso arranques con genio y no se te vaya la voz?

Object

1542Object23/06/2002 01:22:23

¿Te gustaría realizar incursiones en otros campos artisticos como el cine?

Object

1543Object23/06/2002 01:25:16

Hola corazón,mi pregunta es la siguiente,¿tu eres consciente de que ahora eres un artistazo,y que mucha gente(como yo)daría lo que fuera por verte?¿como llevas eso de estar colgado en las habitaciones de millones de fans para las que tu eres lo máximo?T.Q.M.nunca cambies Maria Angeles,Valencia

Object

1544Object23/06/2002 01:25:19

Hola David.Solo decirte que ya eres un gran artista y tienes una voz impresionante.Pero ante todo, tú nos has conquistado por tu corazón,y tu sensibilidad por favor trata de no perderlo nunca,rodeate de tu familia que es maravillosa y ten cuidado porque en este mundo hay mucho interés....No se si Gisela y tú sois pareja o no y no me importa pero a ella se la ve que te aprecia,que te quiere, asi que cuidaros si teneis la oportunidad mutuamente.Un beso mi niño.Se te quiere mucho.Verónica Burgos (beita-78).Por favor no pierdas tu esencia

Object

1545Object23/06/2002 01:27:24

Hola "Gustamante" (que asi te dice mi hermanita), queria decite que tienes una gran voz y que vas a llegar muy lejos. y preguntarte como te sientes con esto de los discos vendidos y esas ventas tan acceleradas? Saludos a Rosa y porfa dile que me llame que yo le di mi numero, cuando chateamos juntos en Eurovision. que me hace mucha illusion. "Camilillo" Camilo.

Object

1546Object23/06/2002 01:27:25

Bustamante estarias dispuesto a dedicarme una cancion?me gustaria que ma la dedicaras a yolanda de palma de mallorca.Qua sepas que desde que te oí en operacion triunfo me enamore de tu voz y de ti un beso guapeton.Espero conocerte algun dia aunque sera imposible.

Object

1547Object23/06/2002 01:28:11

CÓMO ES TU CHICA IDEAL?

Object

1548Object23/06/2002 01:28:14

¿Qué es lo que más te gusta de la fama? De parte de Raquel (Valencia)

Object

1549Object23/06/2002 01:28:58

Hola Bustamante wapoooooo.¿Qué tal te parece ir con Vero de gira?

Object

1550Object23/06/2002 01:29:04

¿Por qué no venis tú y Vero a Palencia? Es muy injusto que la gente que vive en pueblos o en ciudades pequeñas tenga que ir a ciudades como "Barcelona" o "Madrid".. Chenoa y Bisbal van a venir, y también queremos que vengais tú y Vero. Un saludo: Tu fan numero 1

Object

1551Object23/06/2002 01:29:14

Hola Bustamante wapoooooo.¿Qué tal te parece ir con Vero de gira? Raquel (Valencia)

Object

1552Object23/06/2002 01:30:42

¿Por qué tú y gisela ya no estais juntos?? en la academia estabais muy "encarameladitos".. no lo niegues!!! un saludo de una gran fan tuya y de gisela

Object

1553Object23/06/2002 01:32:05

Te quiero felicitar por el magnífico artista que eres, y lo has demostrada al ser la estrella de tu programa homenaje emitido el pasado martes 18 por TVE1. Con tu personalidad, saber estar y fundamentalmente por tu voz llegaras donde tu quieras. Y como ha dicho Miguel Gallardo "no conozco los límites de David". Gracias y dános muchísimos discos para poder disfrutar.

Object

1554Object23/06/2002 01:34:51

hola busta¡¡¡.me llamo marta soy de jaen me gustaria saber si vienes por aqui.y ojala que sea con vero¡¡¡.haceis una pareja buenisima.un beso.tu fan marta.muac

Object

1555Object23/06/2002 01:35:24

hola bustamante me gustaria saber de los concursantes con quien te has llevado peor

Object

1556Object23/06/2002 01:36:28

hola busta.me llamo marta y soy de jaen me gustaria saber si vienes por aqui y si es posible con vero¡¡me encantais y haceis muy buena pareja.un beso.tu fan.marta

Object

1557Object23/06/2002 01:37:35

Hola David! Si encontraras una lampara magica, que es lo que le pedirias al genio? Te deseo un monton de suerte! (Irina, Rusia)

Object

1558Object23/06/2002 01:38:31

Hola me llamo Vane,soy de Málaga. Me gustaría saber ¿como tiene que ser tu chica ideal? y si le das más importancia a la belleza interior o a la exterior. Besos de Vane. Espero y quiero que triunfes muchííííísimo y que pueda comprar muchos discos tuyos. ¡¡¡¡¡¡¡¡¡¡¡ ADELANTE TRIUNFADOR!!!!!!!!!!

Object

1559Object23/06/2002 01:45:45

¿Llego a tus manos para tu cumpleaños una tarjeta de una ranita, que decía:has dado el gran salto? La envie a casa de tus tios, pues no localice tu direccion.me haria ilusion saber si la viste.Un beso de tu fan nº1.MªJose Alba Brenes

Object

1560Object23/06/2002 01:46:05

hola guapisimo!!me he enterado que en tu gira en solitario no vas a pasar por valencia,eso es verdad?no te gusto la acogida que tuviste aqui? en nombre de muchas fans tuyas de valencia te pido por favor que nos hagas una visita,muxas gracias y mucha suete.Siempre estaremos contigo.SARA VALENCIA

Object

1561Object23/06/2002 01:50:21

Hola Busta. Jo querría saber si el tema "Cantabria", muy bonita por cierto, será tu siguiente single. Te quiero. Claudia, Girona.

Object

1562Object23/06/2002 01:57:47

hola busta,bueno queria decirte que tu lo eres todo para mi y que daria todo por conocerte .He oido que andan diciendo que en tu gira solitaria vas a dar un concierto en torrelavega ¿es verdad?esque en una revista pone todos tus conciertos pero en torrelavega no sale.Te quiero mas que a nadie.Zaida

Object

1563Object23/06/2002 01:59:13

Busta, ¿de que equipo eres?, sigue asi guapo!!!!!!!, de tu fan nº1, Marta Murcia

Object

1564Object23/06/2002 02:00:15

Si algun dia te llegases a casar,¿Interrumpiria en tu carrera?

Object

1565Object23/06/2002 02:02:38

busta, ¿vas a venir a Murcia a firmar tu gran disco? ¿cuando? Marta, Murcia

Object

1566Object23/06/2002 02:03:24

hola busta,te escribo otra vez otra pregunta soy la que te he preguntado que si ibas a dar un concierto en otrrelavega queria preguntarte tambien que.¿Cuando vas a venir a madrid a firmar discos?te quiero guapeton eres el mejor.

Object

1567Object23/06/2002 02:08:49

hola david , según creo aparte de querer mucho a tu tierra te gusta mucho asturias ..es así? es q soy de gijón y me gustaría saberlo un beso de lucía te quiero mucho

Object

1568Object23/06/2002 02:08:50

bustamante eres el mejor, y me haces llorar cada vez que cantas creo que vas a triunfar en la vida por lo menos yo voy a comprar todos tus discos. besos bustamante y animo. MIRIAM malaga

Object

1569Object23/06/2002 02:11:13

bustamante ¿vienes a malaga? a dar algun conciento. como no vengas me muero. miriam malaga

Object

1570Object23/06/2002 02:11:20

Busta somos de Alcalá de Henares y queremos desearte mucha suerte con tu disco ya que es un trabajo como la copa un pino. ¿Vas a venir por aquí este verano o por Benidorm? si es así dime la feche por favor. A mi hermana pequeña le encantas y le gustaría verte aunque ya os vimos a todos en los dos conciertos que realizásteis en madrid los días 1 y 2. Fernando y Lorena.

Object

1571Object23/06/2002 02:12:26

Hola David!!!soy Patricia de Madrid Estuve en el concierto que ofrecisteis en el Bernabeu!!!fue impresionante...soys geniales!!gracias por ser como eres.Mi pregunta es la siguiente!!!dónde podemos enviaros cartas?? gracias Un beso

Object

1572Object23/06/2002 02:13:17

DAVID, TIENES EL CORAZON OCUPADO POR ALGUIEN? CON QUIEN TE INSPIRABAS EN CANTAR LA CANCIÓN CUANDO HACEMOS EL AMOR? MUCHOS BESOS. MARTA DE MOLLERUSSA

Object

1573Object23/06/2002 02:16:01

hola david soy una fan tuya de palma de mallorca y me gustaria saber: ¿Que es lo que tu piensa de tus fans? por que hay muchos canatantes que no las quieren.

Object

1574Object23/06/2002 02:16:16

has estado enamorado en la academia a parte d la musica?(no mandes balones fuera, porfa)muaaaaaa desde mallorca para el mas guapo.te keremos.

Object

1575Object23/06/2002 02:18:15

hola ! ¿como va la venta de tus discos ? ¿te gustaria componer alguna vez una cancion para tu propio disco ? Rocio,Madrid

Object

1576Object23/06/2002 02:19:57

Te parece justo que en tu gira, tu cantes 45 minutos,y que Vero solo 25? Tu disco es precioso. Muchos besos.

Object

1577Object23/06/2002 02:21:49

David,¿tu crees que es posible compensar a tus fans todo el apoyo que has recibido?

Object

1578Object23/06/2002 02:23:01

Davis.¿tu crees que es posible compensar a tus fans todo el apoyo que has recibido?

Object

1579Object23/06/2002 02:24:28

Quisiera mandarte un fuerte abrazo y que me dijeras cuando vas a venir a Barcelona de gira. Eres una gran persona y un gran artista. No cambies nunca. Ana María.

Object

1580Object23/06/2002 02:25:10

Hola David! Me gustaría preguntarte cuál es la canción que mas te gusta de tu album y con cual te identificas mas como persona. Gracias y un beso muy fuerte. Beatriz, una fan de Alcañiz

Object

1581Object23/06/2002 02:26:27

¿Qué nos espera en la extensa gira durante 3 meses que vas a realizar?

Object

1582Object23/06/2002 02:26:38

hola david,¿que hubieras hecho si no hubieras tenido esta gran oportunidad?¿seguirias intentando tu sueño??besos mayte

Object

1583Object23/06/2002 02:27:08

Hola David, soy de Valencia,soy una gran fan tuya, y desde aqui te deseo lo mejor del mundo y preguntarte ¿cuando vendras a firmar a Valencia? y ¿que haras despues de la gira española? MUCHOS BESITOS DESDE TU CLUB DE FANS PAULA

Object

1584Object23/06/2002 02:27:33

Hola,soy Laura,una chica de Valencia que quiere decirte que mires siempre hacia delante y nunca te rindas,porque cuando pase el tiempo seguirás estando en algún corazoncito,asi que lucha por ellos para que todos podamos seguir soñando por mucho tiempo.

Object

1585Object23/06/2002 02:30:05

hola bustamante, me encantaria conocerte eres el que mas me ha gustado de operaciontriunfo desde el primer dia, y me encantaria conocerte, no puede ir al concierto q hicisteis aqui porque me kede sin entradas.vas a volver a donosti( san sebastian) 1 beso guapisimo siempre estare contigo.y nunca te olvidare.Ainhoa.

Object

1586Object23/06/2002 02:31:40

vas a venir a donosti a hacer algun concierto? porque si vienes me encantaria ir a verte., 1 beso guapipisimo. y sigue adelante que eres el mejor de operacion triunfo.

Object

1587Object23/06/2002 02:36:58

hola david Bustamante soy una fan tuya de barcelona llebo desde q comenzó operacion animandote tengo 13 años te iba a preguntar a un cosilla . cuando haràs un concierto en barcelona? muchas gracias y desde aqui te mando besos

Object

1588Object23/06/2002 02:37:55

¿Que te gustaría que la gente pensra d ti como persona?

Object

1589Object23/06/2002 02:42:41

Hola David me podrias decir cantaras en sevilla y como fue el castings de lluvia de estrellas. Un beso, guapo a ti y a Alex sois los mejores.

Object

1590Object23/06/2002 02:42:58

hola david es posible q en esta gira puedas pasar por tenerife? espero q si besos una tinerfeña

Object

1591Object23/06/2002 02:44:33

Hola David, soy una fan tuya d Granada y he visto que en tu gira en este verano no vas a pasar por aqui,¿por qué? Yo quería ir a verte y ahora no sé si podré verte y como yo habrá más gente. Besos y sigue así guapetón. Rosalía

Object

1592Object23/06/2002 02:46:08

ola wapisimo!cuentanos alguna anecdota q t aya pasao en estas ultimas semanas con alguna fan!!yo soy la q estaba en barajas(madrid)kon 2 amigas!la q yoraba :) t.q.m

Object

1593Object23/06/2002 02:46:45

Hola David soy una fan tuya de Granada. Me gustaría verte este verano en la gira, pero lo malo es que no pasa por aquí,¿por qué? Y como yo habrá más gente. Besos y sigue así guapetón. Rosalía

Object

1594Object23/06/2002 02:47:20

tienes novia????? o amiga intima????????

Object

1595Object23/06/2002 02:50:41

Kieres casarte conmigo¿?

Object

1596Object23/06/2002 02:51:46

hola soy nuria me gustaria que en el concierto de palamos me saludases me gusta mucho tu disco

Object

1597Object23/06/2002 02:53:41

Hola David: Lo primero es felicitarte por ser como eres, es decir, un cielo de persona, por tener una voz prodigiosa, para mí la mejor y con mucha diferencia, espero lo que la cuides y que sigas adquiriendo técnica, ¿Qué vas a hacer con la beca que te dieron en la final, dónde irás a estudiar? Lo segundo, es felicitarte a tí y a tu productor por ese trabajo tan bien elaborado, todas las canciones que compone tu primer CD son estupendas, si tengo que quedarme con una me quedaría con Duda de amor:), quizá por circunstancias personales que me han tocado vivir en estos momentos, y La Magia del Corazón que no será la mejor de tu CD pero si para todos nosotros es un "HIMNO", y de las tres canciones "dejadas" para Eurovisión, la mejor, aunque no sea festivalera. De las moviditas,jeje.., todas te hacen ponerte en movimiento, jejej..., aunque ese Aire que me das, se sale bastante de lo corriente. He visto la gala Bustamante y amigos, únicamente te diré AUPA CÁNTABRO y no tengas "miedo" a mover tu cuerpo sobre el escenario que hay muy poquitos que lo pueden hacer como tu y que tengan para mover lo que tu tienes, jejej.. Por último, me gustaría verte en algún musical y con algo de ópera, ¿Podrá ser? Un abrazo y hasta siempre xucachu, Mª Jesús LLado, Córdoba

Object

1598Object23/06/2002 02:55:11

Soy una chica de cantabria y me gustaria saber que que es lo que más admiras de nuestra tierra?

Object

1599Object23/06/2002 02:55:59

Hola David, me llamo Olga y soy de Madrid. ¿Te gustaría cantar en un futuro en otro idioma, como en italiano, por ejemplo? Creo que te iría muy bien. Suerte y adelante.

Object

1600Object23/06/2002 02:57:56

¿Tienes el sueño de visitar algún país en especial y poder dar en él algún concierto? Saludos desde Madrid. Olga.

Object

1601Object23/06/2002 02:58:42

Array

Object

1602Object23/06/2002 02:59:02

hola david soy elias.gracias por firmarme el cd lo siento por no poder ir ala cena.q sepas que san vicente te quiere sigue asi q llegaras muy lejos.campeon!!!!un abrazo elias.enhorabuena por tu triunfo.chAO

Object

1603Object23/06/2002 02:59:50

HOLA DAVID SOY ELIAS SABES SI VENDRAS A SAN VICENTE DE LA ABARQ

Object

1604Object23/06/2002 03:01:34

HOLA DAVID SOY ELIAS SABES SI VENDRAS A SANB VCIENTE A FIRMAR?YO YA LO TENGO FIRMADO GRACIAS TE DESEO LO MEJOR ESTAMOS ESPERANDO IMPOACIENTES A QUE SEAS 10 DE AGOSTO PARA VERTE EN LA TIERRA EN CONCIERTO.ENHORABUENA CAMPEON SIGUE ASI

Object

1605Object23/06/2002 03:02:47

¿A qué se debe tu soltura en los programas?¿El éxito que tienes entre las chicas te da más confianza?Eres un gran cantante.La morena de Crónicas

Object

1606Object23/06/2002 03:05:10

BUSTI ERES LO MEJOR QUE PASO POR LA ACADEMIA PERO AHORA ERES UNO DE LOS MEJORES EN EL PANORAMA DE LA MUSICA EN ESPAÑA. KOMO LLEVAS EL TEMA DE LA FAMA Y LOS FANS? ERES CONSCIENTE DE QUE MILES DE CHICAS SUSPIRAN CADA NOCHE PENSANDO EN TI? NUNCA DEJES DE SER TU Y MUESTRATE TAL Y COMO ERES Y POR FAVOR NUNCA DEJES DE SALUDAR A AQUELLAS K KREYERON EN TI DESDE EL PRIMER DIA,AKELLAS PERSONAS K KOMPRARON TUS DISKOS DAVID, ES MUY DIFICIL K TE KONOZKAMOS EN PERSONA POR SIMPLEMENTE KON UN GRACIAS O UN OS KIERO DESDE KUALKIER MEDIO DE KOMUNICACION NOS SENTIMOS REKOMPENSADAS...NO TE OLVIDES NUNKA DE ESTO..ENORABUENA POR TU DISKO YA K ES INMEJORABLE!POR CIERTO KUANTOS DISKOS LLEVAS VENDIDOS? ESPERO K PRONTO ALKANZEMOS ENTRE TODOS NUESTRO PROPOSITO:EL DIAMANTE!BSSOS DESDE LOGROÑO.EVA

Object

1607Object23/06/2002 03:05:40

Hola David, somos Jessica y Elena de Cornella de Llobregat, la semana pasada te enviamos un regalito y no sabemos si te ha llegado y te ha gustado, me supongo que leyendo los nombres sabras de que regalo te estamos hablando. Nos gustaria saber si te ha llegado. Muchos besos campeón y sigue asi. Te queremos. (porfavor mostrarle esta pregunta. Gracias)

Object

1608Object23/06/2002 03:07:05

Hola David primero decirte que eres el mejor artista de estos momentos y espero que lo seas durante mucho tiempo mas, como llevas esto de la fama¿? por lo que puedo ver en la tele sigues siendo el mismo chico que entro en la academia verdad¿?. Cristina BCN

Object

1609Object23/06/2002 03:07:39

¿POR QUE SE TE OCURRIO SALIR DESNUDO EN UNA FOTO DE TU DISCO?NO SEAS GUARRO!!!!!!!!!!POR QUE YO TE QUIERO MUCHISIMO PERO NO ME GUSTA QUE HAGAS ESO!!!!!

Object

1610Object23/06/2002 03:08:38

Por que un hombre sea sensible y llore la gente lo trata como un niño y un lloron. ¿Te enfadas cuando te lo dicen y te lo tomas en cachondeo? bs. Virgy

Object

1611Object23/06/2002 03:10:45

Hola David!!!!! Soy una catalana a la que le encanta tu trabajo. Queria preguntarte que cuando empezaras tu gira? Tambien queria preguntarte que cuando vendras al centro comercial Glorias de Barcelona a firmar discos? Un beso!!! Gracias!!!

Object

1612Object23/06/2002 03:12:15

Buenas!! por que no te vienes a Euskadi de concierto y nos rodeas completamente??ahora me voy a tener que gastar mogollon de dinero en ir a verte, pero por ti, hago lo que sea.Eres el mejor!!!

Object

1613Object23/06/2002 03:12:20

Que opinas de que una mujer con 38 años,le guste todo de ti..la gente opina que a mi edad eso no se lleva..jamás había sido fan de nadie, pero tú me gustas, o tu consideras que solo eres para las de tu edad?..Lou de Sant Celoni

Object

1614Object23/06/2002 03:14:57

Hola David ¿Que sientes cuando te subes a un escenario con todos tus fans gritando tu nombre? Un beso Suerte! Mesulam (La Linea)

Object

1615Object23/06/2002 03:16:21

Hola David, ¿Que sientes sobre un escenario? Un beso y mucha suerte Mesulam (La Linea)

Object

1616Object23/06/2002 03:16:22

Todo el mundo cree que la popularidad, de una u otra manera estropea, por asi decirlo, el caracter,la sencillez, el dia a dia que hasta ahora has tenido¿Temes este cambio en tí?¿Lo teme tu madre?

Object

1617Object23/06/2002 03:20:15

¿Por qué no vienes a dar un concierto a San Sebastián? Esque eres mi favorito y me encantas y quiero que vengas. POR FAVOR

Object

1618Object23/06/2002 03:21:57

Hola David! Aqui tienes mi pregunta: Todos tus fans hemos aprendido mucho de ti ¿tu has aprendido algo de nosotros? Un beso Mesulam (La Linea)

Object

1619Object23/06/2002 03:22:50

Hola, buenos dias: me gustaria saber cuando es la firma de discos en alicante y en que lugar va a ser. Un besazo de la fan que mas te quiere y nunca te olvida. Raquel de Alicante.

Object

1620Object23/06/2002 03:25:08

Hola Busta!!!Me llamo Silvia y soy una fan tuya de Barcelona.Ahora que te conozco como artista lo que mas desearia es conocerte como persona,pork si como artista me pareces "increible" como persona debes ser un cielo.Sé que probablemente nunca pueda cumplir mi sueño de tenerte como amigo pero al menos me gustaria poder verte en una firma de discos y cruzar un par de palabras contigo por eso te pido porfavor que me digas para cuando tienes previsto firmar discos en Barcelona.Tambien quisiera decirte que tu disco es lo mas dulce y bonito que he oido en mi vida junto a tu voz,no dejes nunca que la fama te cambie o lo perderas todo.Y si alguna vez te sientes triste parate a pensar en a cuanta gente le importas y se feliz, no te derrumbes nunca,yo y muchas fans mas siempre te apoyaremos.Ah y otra pregunta,¿cuando vas a entrar al foro?? nos tienes abandonados.Venga me despido ya,un beso muy grande, con todo mi cariño para a la gran persona que tu eres.tk

Object

1621Object23/06/2002 03:27:15

hola Busta!!q tal?me gustaria saber si vas a venir por Mallorca pronto,te vi en el concierto pero me gustaria verte otra vez.Bueno,muchos bsos,me encanta como eres,sigue asi guapisimo!!!se te quiere. Sara

Object

1622Object23/06/2002 03:27:18

Bustamante, me podrias hacer un favor??? eske yo vivo en mostoles (madrid) y te queria pedir si podrias actuar en mostoles xk cuando actuas en madrid mis padres no me degan ir xk ellos no me pueden llebar y encima solo tengo 11 años y entoces soy muy pequeña para ir sola a madrid no crees??

Object

1623Object23/06/2002 03:27:21

BUSTAMANTE SOLO VIENES UN DIA A MADRID A ARANJUEZ POR QUE NO A PODIDO SER UN POCO MAS CERCA DEL CENTRO. .guapetonnnnnnnnn¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡ simpatico¡¡¡¡¡¡¡¡¡¡ y otra pregunta poir el dia 30 de abril estuvistes tan serio en el concierto de madrid besos .m angeles(madrid)

Object

1624Object23/06/2002 03:28:04

soy virginia de zaragoza, queria saber si vas a dar algun concierto en solitario en zaragoza.Si porfavor que estoy deseando verte otra vez.ADIOS WAPO Y MUCHOS BESOS

Object

1625Object23/06/2002 03:29:09

Hola david fue dura la grabacion de tu disco??.De una fan.te quiero

Object

1626Object23/06/2002 03:29:21

tu eres mejor que ese bisbal adelante pudes conseguirlo ¿que se cree que va a alcanzar la fama?

Object

1627Object23/06/2002 03:30:05

Soy una chica de Navarra, me llamo Ainhoa y nací el 25 de marzo me gustaria saber si vas a venir cerca de aquí.

Object

1628Object23/06/2002 03:30:50

¿por que no vas a hacer un concierto en sevilla? me he llevado un disgusto

Object

1629Object23/06/2002 03:31:06

hola ,bustamante por que en el concierto de madrid estuviste muy serio .Otra cosa el dia 7 de septiembre actuas ne aranjuez por que que lo vais hacer tan lejor lo podiais haberlo echo en el centro .bueno besos M angeles sanchez GUAPO¡¡¡¡¡¡ ARTISTRA¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

Object

1630Object23/06/2002 03:32:17

Hola dabid, me llamo Natalia y soy de Montevideo Uruguay,y quiero decirte que aca todo el mundo conoce tus canciones aunque el disco no este a la venta aun. Mi pregunta es si tienes idea de la polularidad que tienes en America Latina? Y si en los planes tiene hacer una gira por Sudamerica??

Object

1631Object23/06/2002 03:33:10

Soy Silvia, de Barcelona y me gustaria preguntarte un par de cosas: ¿Cuando firmaras discos en Barcelona?? ¿Cuando entraras en el foro?? Porfavor contestame y me haras muy feliz. Ahora que te conozco como artista,lo que mas deseo es conocerte como persona,y que si como artista eres increible como persona debes ser un cielo.Pero como probablemente no podre cumplir mi sueño de ser tu amiga me gustaria que me contestaras a estas dos preguntas para poder hablar contigo ni que sea un minuto.tk de corazon,que la fama no te haga cambiar.Nunca te derrumbes siempre habra gente como yo dispuesto a estar siempre a tu lado.Un beso muy grande con mucho cariño para la gran persona que tu ers.tk

Object

1632Object23/06/2002 03:37:08

Cuando digiste que a ti tus cantantes favoritos te hacian conmoverte y tambien digiste que a ti tambien te gustaría conmover atus fans, ¿pero no crees que ya los has logrado conmover? ¿Y que estarías dispuesto a hacer por un fan tuyo? Bueno mucha suerte artistazo que tu si que tienes un corazón que no te cabe dentro.

Object

1633Object23/06/2002 03:37:29

Q tengo que hacer para chatear con bustamante? Asta que hora estara el??

Object

1634Object23/06/2002 03:38:37

hola bustamante como has conseguido esas ventas, creo que se debe a tu gran personalidad,voz y sobre todo a esos productores que tienes pero seguro que hay algo mas dinos.un beso enorme y un saludo para tus padres y hermanos. pd/soy itziar casquero de santander gran fan tuya

Object

1635Object23/06/2002 03:38:40

¿cuand vas a venir a cantabria?

Object

1636Object23/06/2002 03:39:15

¿Que es lo que más te ha sorprendido que a hecho un fan por ti? ¿Serías tu capaz de hacerlo por alguien?

Object

1637Object23/06/2002 03:39:53

Hola David, guapo, me gustaría saber si lees las cartas que te mandamos tus fans. Yo mandé una a la Academia de Artista, por favor si las lees mándanos un autógrafo y es que como tú ya sabes, tus fans te adoramos. Un beso y mucha suerte. LAURA SEVILLA.

Object

1638Object23/06/2002 03:40:13

Busta no te hubiera gustado cantar en alguna gala con Rosa?hariais un gran dúo. ¿sabes cuando vienes a Valencia a firmar discos? ¿y donde? gracias eres increible. te queremos

Object

1639Object23/06/2002 03:41:04

¿con cual de las canciones de tu nuevo disco te sientes mas identificado y porque? besos caro

Object

1640Object23/06/2002 03:42:18

¿Has pensado en dedicarte a la interpretación?, Creo que tienes dotes de actor,¿Que opinas de trabajar en otros campos del espectáculo?

Object

1641Object23/06/2002 03:43:07

hola soy jennifer desde holanda, y queria saber si has pensado en hacerte internacional para que te conozca todo el mundo un beso grande desde holanda

Object

1642Object23/06/2002 03:43:10

David, ¿podrías cantarma algo ?

Object

1643Object23/06/2002 03:43:54

Se dijo algo de que proximo single sera "El aire que me das",¿no habeis pesado en "Besos"?Las dos son geniales,pero Besos estaria muy bien para ponerla como cancion para verano. Busta,guapisimo,siempre bien arriba!!A ver cuando te pasas por tu foro.besos.Marta(Valencia)

Object

1644Object23/06/2002 03:45:07

¿Cómo sería tu chica ideal? AQUI EN ZARAGOZA TE QUEREMOS MUCHO. Laura y Rosa

Object

1645Object23/06/2002 03:45:47

porque no tienes novia

Object

1646Object23/06/2002 03:45:51

Hola corazón!!¿crees que algun dia te cansaras de atender a tus fans tan bien como ahora?Enhorabuena por todo,y GRACIAS por todo lo que nos transmites!!Un besazo enorme,nos vemos el 10 de julio!!Lorena(l´Olleria/Valencia)

Object

1647Object23/06/2002 03:47:35

Hola Busta, me encanta tu disco pero estoy muy disgustada porque no vienes a Sevilla y me es imposible desplazarme a otro lugar. Por ello me gustaría preguntarte si vienes a algún lugar cerca de mi ciudad. Espero poder ir a verte. Un beso, Laura Sevilla.

Object

1648Object23/06/2002 03:48:32

¿ESTAS SATISFECHO CON TU NUEVO DISCO? UN ABRAZO MARILO(GRANADA, VIVA ROSA)

Object

1649Object23/06/2002 03:51:06

¿EN TU GIRA EN SOLITARIO VAS A PASAR POR SAN SEBASTIAN(GIPUZKOA)? (CLEO)

Object

1650Object23/06/2002 03:55:24

Tú eres tan sentimental y romántico como se te ve en el programa de Operación Triunfo? Genoveva, de La Republica Dominicana

Object

1651Object23/06/2002 03:56:04

HOLA BUSTA, SOY UNA MANCHEGA QUE TE ADORA. QUIERO DECIRTE QUE ERES UNA PERSONA MUY HUMILDE Y ESPONTÁNEA Y, SOBRE TODO UN GRAN ARTISTA. ADEMÁS TU CORAZÓN ES GRANDE COMO EL CIELO. QUERÍA PREGUNTARTE POR QUÉ INTENTASTE EXCUSAR A MARCOS LLUNAS DE LA CANCIÓN QUE IBA PARA TÍ Y AHORA ESTA EN SU DISCO. MUCHOS BESITOS. SUEÑO PODER CONOCERTE ALGUN DÍA. AH!!SOY DE ALCAZAR DE SAN JUAN Y ALEJANDRO, GISELA Y NATI VIENEN AQUI A DAR UN CONCIERTO. TE PODIAS HABER VENIDO TU!!! TE QUIERO.

Object

1652Object23/06/2002 04:02:23

HOLA DAVID!!! Soy Malia de Barcelona. Estuve en Tallinn y pude conocerte. Me encandilaste! Si ya eres buen cantante todavía eres mejor persona. Pude comprobar que sigues siendo un chico muy normal pero ¿qué te ha aportado la fama que te haya hecho cambiar (siempre a mejor)? Nos vemos de gira en Barcelona y en Andalucía. Muchísimos besos! MUCHA MIERDA! Y siempre pa'lante!!!

Object

1653Object23/06/2002 04:02:59

BUSTA ME PUEDES DECIR DONDE PUEDO COMPRAR LAS ENTRADAS DE TUS CONCIERTOS CON VERO¿¿? I OTRA KOSA DE KE EQUIPO ERES¿¿??? GRACIAS POR RESPONDER ERES EL MEJORRRRR

Object

1654Object23/06/2002 04:04:35

Hola Busta. Tu disco es fantástico, me puedes decir cúal es la canción con la que te sientes más identificado. Te quiere tu fan 1º

Object

1655Object23/06/2002 04:05:47

hola Bustamante yo te querria preguntar,que tal te lo pasate en las Palmas de Gran Canaria, y me gustaria que volvieses aqui todos te quieren.un beso my fuerte.te esperamos.

Object

1656Object23/06/2002 04:07:32

¿david por què eres ta nguapo?

Object

1657Object23/06/2002 04:07:49

Hola somos Lucía y Fani de zaragoza . Nos encanta la canción que cantas en el cd con Alex, ¿volverías a cantar con él en algún otro disco? Sois los mejores tu y Alex! un besazo!

Object

1658Object23/06/2002 04:07:56

Aunque todas las canciones de tu album son estupendas, ¿cuál es tu favorito?

Object

1659Object23/06/2002 04:08:31

Es verdad que has vendido mas de 1500000 copias de tu disco?

Object

1660Object23/06/2002 04:08:34

¿david por què eres tan guapo?

Object

1661Object23/06/2002 04:10:01

Hola David, he estado viendo los lugares de tus conciertos y no actuas en Extremadura, ¿por qué?, ?no te gustó la experiencia en el concierto de los 16?, espero que me contestes. Besazos. Rocío

Object

1662Object23/06/2002 04:11:45

En la Academia ensayabais mucho, y os cansabais, en esos momentos de bajón,¿que pensabais, para seguir luchando?

Object

1663Object23/06/2002 04:12:32

Hola David,bueno solo decirte que eres uno de los mejores y que siempre estaras en mi vida de una forma o de otra. ERES EL MEJOR. Me gustaria conocerte pero ahora es imposible. Mi pregunta: ¿Qué sientes cuando te oyes en la radio o te ves en la tele? Seguro que antes ni te lo imaginarias.

Object

1664Object23/06/2002 04:14:08

En la Academia trabajabais duro y os cansabais, ¿en que pensabais para recuperar fuerzas?

Object

1665Object23/06/2002 04:14:30

Hola Busta soy Ivanka y el 22 estuve en el parque Santa Catalina en Las Palmas y tambien estuve en la firma durante 4h y 30 y no te dio tiempo a que me firmaras. Lo unico que te digo es que me perdones ya que nos pasamos al decir que era injusto ya que tu no tienes la culpa de nada, que te quiero mucho y que te estaré esperando el 27 de Julio aqui y en los conciertos de Santander que te voy a segir. Y la pregunta era que donde va a ser el concierto del 27 aqui que no lo pone en ningun sitio y donde se compran las entrsdas? Besos y sigue asi campeon.

Object

1666Object23/06/2002 04:15:02

Cuando va a venir a donosti?

Object

1667Object23/06/2002 04:16:12

¿Vas a benir a firmar discos en valencia capital?

Object

1668Object23/06/2002 04:16:31

HOLA PRECIOSO!!!TU SUEÑO SE HA REALIZADO NO???ME ALEGRO MUCHISIMO PORQUE EL MIO A LA VEZ TAMBIEN SE HA CUMPLIDO,NUNCA ME HA ENAMORADO TANTO UN CAVAL COMO TU Y MENOS NUNCA ME HAN ENAMORADO CN LA VOZ Y TU LO AS ECHO!!!CON 14 AÑOS MI MADRE ME TOMA COMO "LOCA"...YA SALGO MENOS CON MIS AMIGAS,AHORA ME QUEDO EN CASA OYENDO TU MUSICA,VIENDO LOS VIDEOS DE O.T CUANDO ESTABAS EN LA ACADEMIA... BUENO,COMO NO TENGO MUCHO PARA CONTARTE POR AQUI SOLO QUIERO QUE SEPAS QUE TIENES UNA FIEL SEGUIDORA EN BILBAO,ESPERO QUE NO TE OLVIDES DE TUS SEGUIDORAS DE BILBAO Y ESPERO QUE VENGAS PRONTO...DE MOMENTO EL 30 D ESTE MES VOY A CONOCER A TUS HERMANOS EN UNA KEDADA Y LE DARE UNA CARTA,PELUCHE ETC... PA QUE TE DEN OK?TAMBIEN ESTARAN ADA Y TITO...QUE SEPAS QUE SOYS TODOS MUY MAJOS...CUANDO VIENES PA BILBAO A FIRMAR???BESAZOS DE TU FIEL SEGUIDORA QUE AUNQUE ESTA LEJOS DE TI NO TE HA OLVIDADO TE LLEVO DENTRO DE MI CORAZON CON LETRAS DE ORO BORDADO...VALE¿?TE QUIERO!!!!WAPISIMO!!!PRECIOSO!!TIO WENO!!!BUSTA Y GISELA LOS MEJORES!!!TU MAS EH?JEJE

Object

1669Object23/06/2002 04:22:13

Busta, soy un fans tuyo desde que entrastes en la Academia y a hora que has grabado tu propio disco, más aún.¿Cómo sienta el triunfo? ¿Es como te lo imaginabas? Espero que todo te vaya de lujo o como dice Rosana, que te vaya bonito.

Object

1670Object23/06/2002 04:24:00

Hola Busta ¿Qué es lo que más hechas de menos de tu vida antes de Operación Triunfo? Te deseo mucha suerte y espero que nunca cambies porque eres un gran artista pero mejor persona y eso es lo más bonito de tí. Un beso, guapetón. Laura Sevilla.

Object

1671Object23/06/2002 04:24:55

¿como es tu vida despues de este cambio tan grande? ¿estas feliz de que todos te queramos tanto?¿te lo esperabas?

Object

1672Object23/06/2002 04:26:03

David, soy Maria de Barcelona. Tengo 52 años, así que no soy ninguna adolescente. ¿Te das cuenta de que tu ilusión y la de tus compañeros por la música nos alcanza también a los de mi edad? Gracias por tu música y tus canciones, y que el éxito tan rápido no se te suba a la cabeza. !Sigue como eres y sigue progresando!

Object

1673Object23/06/2002 04:29:24

DAVID, PRIMERO QUE NADA FELICIDADES POR TU EXITO SOY MARISOL Y VIVO EN MERIDA, YUCATAN MEXICO QUISIERA SABER CUANDO VIENES A MEXICO.

Object

1674Object23/06/2002 04:32:08

Me he informado de los conciertos que vas ha hacer...Yo vivo en Castellon,pero me gustaria saber,si a parte de ir a Almazora(un pueblo de castellon)vas a venir a la ciudad a dar un concierto como van a hacer Bisbal y Chenoa el proximo 13 de julio.Eres el mejor BUSTA!!!

Object

1675Object23/06/2002 04:32:42

HOLA DAVID, QUE TAL? BUENO, QUE ME GUSTAS UN MONTON Y MI PREGUNTA ES: ¿NO OS DISTANCIAREIS TUS COMPAÑEROS DE LA ACADEMIA Y TU EN ESTOS MOMENTOS DE MAXIMA FAMA INDIVIDUAL DE CADA UNO?ESQUE ME GUSTAIS MUCHIIIIIISSSSIIIIMO TODOS Y ME GUSTARIA QUE SIEMPRE FUERAIS LOS MISMOS CHICOS CAPACES DE EMOCIONARSE Y SENTIR COMO PERSONAS DE LA CALLE NORMALES Y CORRIENTES...VAMOS, QUE NO SE OS SUBA LA FAMA A LA CABEZA!!UN BESO A TI Y A TODOS TUS COMPIS. ELIA (MADRID)

Object

1676Object23/06/2002 04:33:15

¿Cuándo vuelves a Las Palmas de Gran Canaria y a qué parte de la isla?Muchos besos y abrazos

Object

1677Object23/06/2002 04:34:22

vas a dar algun concierto en San Sebatian??

Object

1678Object23/06/2002 04:36:58

Hola David eres el mejor, nunca cambies. Te queremos mucho todas tus fans guapetón. Rosalía

Object

1679Object23/06/2002 04:37:37

hola busta!que tal artistazo?bueno queria decirte que en tu disco se ve todo el esfuerzo,cariño,empeño,alegria y trabajo que has puesto y eso se nota en la voz asique solo decir que ole por ese disco y si me podias cantar un cachito de si tengo que morir,(llore al oirla) y que te quiero sige asi. un besazo de busta100(mi nick de tu chat)o pituchi

Object

1680Object23/06/2002 04:40:41

hola busta: me gustaria saber lo q pensaste del arbitrage en el partido españa--korea. un besote muy grande para ti ,guapo!!!! ^izara^

Object

1681Object23/06/2002 04:41:48

Busta me encanta tu disco pero me gustaria saber si vas a venir pronto a Madrid y cuando

Object

1682Object23/06/2002 04:43:40

hola david!!, fui al concierto de sevilla de OT y la verdad estuvo,buagg!! faltan palabras,eres una persona que tiene mucho carisma;el otro dia en casa de mi tia descubrimos que tienes un nuevo admirador, mi tia esta embarazada de 8 meses, pusimos, tu CD,( por cierto muy bueno) y el niño se empezo a mover,q gracia nos hizo, pero es que cuando lo quitamos, se paro,jejeje, lo hicmos varias veces y podemos decir que le gusta tu musica, bueno, soy muy malas para las preguntas, asi que haya va: ¿que es lo que esperas a partir de ahora?, nada mas un beso y que siga tu particular Operacion Triunfo.

Object

1683Object23/06/2002 04:43:48

Hola David Soy una chica de cantabria y queria preguntarte como puedes cantar siempre tan bien y si vas a venir a firmar autografos a cantabria. Cristina(santander)

Object

1684Object23/06/2002 04:44:26

¿vas a pasar por donosti?(smat)

Object

1685Object23/06/2002 04:45:15

BUSTA, Q HACES PARA QUE LAS CHICAS SE FIJEN EN TI? YO NO SOY COMO TU DE ATRACTICO PERO, TIENES ALGUN CONSEJO PARA DARME?GRACIAS. M GUSTA TU DICO Y SOBRE TODO LA BALA DA CON ALEX "DOS HOMBRES Y UN DESTINO. YO SIENTO ALGO ASI POR UNA CHICA PERO NO SE FIJA EN MI Q PUEDO HACER? DALE UN ABRAZO A, D.BISBAL,CHENOA,NURIA,MANU,GISELA,ROSA,ALEJANDRO,VERRONICA, MIREIA,GENO,JAVIAN,ALEX,NAIM. MI NOMBRE ES JAVI TENGO 18 AÑOS Y ESTE ES MI TELEFONO POR SI M QUIERES LLAMAR TU Y CUALQUIERA DE TUS COMPAÑEROS,699769311 SOY DE GUADALUPE CACERES, OTRA COSA DILE A GISELA QUE ESTA BUENISIMA Y ESTOY ENAMORADO DE ELLA Y DE TODAS LAS CHICAS DE O.T. VALE COMPAÑERO HASTA LUEGO ESPERO VUESTRA LLAMADA. SUERTE

Object

1686Object23/06/2002 04:46:42

En un futuro, ¿piensas componer canciones?

Object

1687Object23/06/2002 04:46:50

Hola Busta, ya sabes de todos los discos piratas que se venden por las calles¿Qué opinas sobre este tema de la piratería?¿Crees que entre todos podremos acabar con éste delito que os afecta a todos los artistas? Un beso, guapetón. Laura Sevilla.

Object

1688Object23/06/2002 04:47:49

Que no sea el single, ¿cuál es la canción que más te gusta de tu disco? a la gente le encanta la de:"No soy un supermán"

Object

1689Object23/06/2002 04:47:51

con todo el talento q tienes seguro que puedes componer canciones para tu proximo cd ¿nos deleitaras con una obra maestra realizada por ti?

Object

1690Object23/06/2002 04:48:53

¿A qué sitios vas a ir a firmar discos (porfavor ven a Valencia)?

Object

1691Object23/06/2002 04:49:08

David, ¿es verdad que vas a hacer la gira con Vero?. Espero que sigas así de humilde y que nunca cambies. Un besazo! Maite

Object

1692Object23/06/2002 04:49:21

Si no hubieras tenido la Oportunidad de entrar en la Academia de Operación Triunfo ¿Crees que estarías todavía subido en el andamio? Si eso hubiese sido así se hubiera desaprovechado a un gran cantante. Gracias por estar ahí, un abrazo. Laura Sevilla.

Object

1693Object23/06/2002 04:50:08

En el Hipercor de Las Palmas,¿por qué no le dedicaste más tiempo a firmar, si actuaste tan tarde en el Parque Santa Catalina?Me dejaste sin tu autógrafo, pero me conforme con las 3 canciones que cantaste.Marta, Las Palmas

Object

1694Object23/06/2002 04:50:28

¿Haces toda tu gira acompañado por Gisela? ¿A qué sitios vas? ¿Cuándo? ¿A partir de cuándo se pueden comprar las entradas?

Object

1695Object23/06/2002 04:51:09

¿Chateas a menudo por Internet? ¿En qué chat?

Object

1696Object23/06/2002 04:51:50

Hola BUSTA, me llamo ELISA soy de MALLORCA. Hace ya mucho tiempo que tengo tu disco y quiero saber cuando pasarás por Mallorca para firmar los discos.me hace mucha ilusión poder verte otra vez.Eres genial, sigue asi.

Object

1697Object23/06/2002 04:52:41

grabaras un segundo videoclip ? cual es tu segundo single de tu disco ?

Object

1698Object23/06/2002 04:52:44

Hola David me gustaria preguntarteuna cosa:¿que te parece tu disco? ,¿es de tu agrado?, estas satisfecho con el o querias algo mas? espero tu respuesta. Un beso guapeton.Pilar Maria.

Object

1699Object23/06/2002 04:52:54

¿sigues en contacto con tus compañeros de la academia? .ERES EL MEJOR un beso. Cris

Object

1700Object23/06/2002 04:53:11

David, ¿Cómo has conseguido que la fama que tienes en estos momentos no se te haya subido a la cabeza y seas una persona tan agradable con tu público como eres? Te deseo mucho suerte,un beso. Laura Sevilla.

Object

1701Object23/06/2002 04:55:04

hola soy judith.¿vendras por barcelona en tu gira en solitario? muchos besos y suerte eres el mejor

Object

1702Object23/06/2002 04:55:48

ola david como te sentias cuando te dijo cristian castro los de los tonos jaaaa 1 saludo eres el mejor VIVA SAN VICENTE DE LA BERQUERA pablo campos alicante adios y muxos besoss

Object

1703Object23/06/2002 04:56:42

david vas a venir aqui a san sebastian en tu gira en solitario???????ven por favor.

Object

1704Object23/06/2002 04:57:35

ola soy un chico de 14 años y creo q tu tines mucho futuro pa mi eres el mejor y por k yores no tienes k ser maricon al reves t sce mas ombre VIOVA BUSTAAAAAAAAAAAAAAAAAAAAAAAAA pablo campos alicante

Object

1705Object23/06/2002 04:59:33

Soy una chica de Santander que estudia en Salamanca.¿Participarás en el Festival de la Canción Marinera que se celebrará en San Vicente, creo que el 4 o el 5 de julio?Lo digo porque mi padre cantará con el coro del Palacio de Festivales, y estaría bien verte por ahí y así conseguir autógrafos para alguna de mis amigas, que creo que están loquitas por ti.Gracias por adelantado y adiós, majete, no me cambies. Anuca.

Object

1706Object23/06/2002 05:00:26

como haces para ser tan original??? Matias Turcatti turcacho@hotmail.com PD.estoy en alemania y los miraba siempre por el canal int.

Object

1707Object23/06/2002 05:00:56

hola compañero! ¿que ta hada a nivel personal el trabajar en la construccion? muchos besos de una alicantina.

Object

1708Object23/06/2002 05:00:59

Busta ¿Te imaginabas en tus mejores sueños que ibas a tener tanta fama como tienes ahora en este País donde te queremos y apoyamos tantas personas? Un beso y un gran abrazo. Laura Sevilla.

Object

1709Object23/06/2002 05:01:14

ola lo mejor q me a podido pasar es ir a tu pueblo es el mejor y ma gustao mucho eres el mejor 1 abrazo pablo campos alicante

Object

1710Object23/06/2002 05:01:18

¿Qué te pareció el puesto en el que quedó España en eurovisión? ¿Te esperabas formar parte del coro? ¿Te gustó? A mi no me pareció justo, todo eso es politica, ¡animo que tendriais que haber ganado!, os lo mereciais

Object

1711Object23/06/2002 05:02:31

pablo campos de alicante hice noche por verte e ti y a todos tus kompis soys los mejores tu el 1

Object

1712Object23/06/2002 05:03:18

¿Cuál fue la canción que más te gustó cantar en operación triunfo? ¿cuál fue la persona que más te entristeció que se fuera? ¿te esperabas estar entre los tres ganadores (te lo merecias)? ¿te esperabas ir a Eurovisión?

Object

1713Object23/06/2002 05:04:09

¿Qué canción fue la que más te costó cantar? ¿Por qué? ¿Cuál fue tu profesor favorito?

Object

1714Object23/06/2002 05:04:53

cuando hara firma d discos en bcn? la haras en mataro como nuria fergó el pasado 15 d junio? xk me gustaria muxo verte. y si te enteras de cuando los firma bisbal me lo podrias decir porfavor? gracias te kiero muxo eres el mejor detras d bisbal claro ;)

Object

1715Object23/06/2002 05:05:14

yo tenia una pregunta a nivel personal.¿no crees que os tienen demasiado controlados a los 16?

Object

1716Object23/06/2002 05:05:35

¿Qué opinas sobre la gente que se mete contigo? Yo creo que todo es envidia, porque no te llegan ni a la suela del zapato.

Object

1717Object23/06/2002 05:07:02

David ¿Por qué y quién decidió elegir como singles de tu primer disco "Además de tí"? Pienso que fue una buena elección. Muchos besos, Laura Sevilla.

Object

1718Object23/06/2002 05:09:57

ES CIERTO QUE LOS QUE VAYAMOS A LA ACADEMIA JOVEN DE VERANO PODREMOS ENTRAR EN TU CAMERINO Y HABLAR CONTIGO?T.Q.M NO CAMBIES.ERES EL mejorrrrrrrrr

Object

1719Object23/06/2002 05:10:33

bustamante namoras com alguém ? por favor responde sou uma grande fã tua . te quiero !! besos

Object

1720Object23/06/2002 05:10:37

HOLA CORAZON!SOY LA PRESIDENTA DE TU CLUB EN TENERIFE, EL PASADO DIA 22 ESTUBE EN GRAN CANARIA EN TU FIRMA DE DISCO Y MI PREGUNTA ES , YA QUE NO HACES CONCIERTO EN TENERIFE ¿PODRIA SER POSIBLE QUE HICIERAS UNA FIRMA DE DISCOS? MUCHISIMAS GRACIAS. ERES EL MEJOR!! YURENA TENERIFE(I-LOVE-BUSTAMANTE.)

Object

1721Object23/06/2002 05:13:25

David, que sentiste en la final de Operación Triunfo al escuchar tu nombre como tercer finalista, superando a Chenoa y a Manu que estaban entre todas las apuestas?

Object

1722Object23/06/2002 05:13:39

¿No ivas a hacer un dúo con Sergio Dalma en tu disco?¿Cuál va a ser tu próximo single? Yo te recomendaria que fuera: "No soy un supermán" porque tiene un éxito...

Object

1723Object23/06/2002 05:15:26

¿Se necesita estar enamorado para poner el sentido y sentimiento que pones tus canciones o es que simplemente eres asi de salao?Yo quiero uno como tu, adelante que vales mucho.

Object

1724Object23/06/2002 05:16:47

Hola wapisimo me llamo Sandra Arranz Martinez queria decrite q tu disco inmejorable no me canso de oirlo y queria saber si en el concierto te pasa x Barcelona ya q loe mirado y pone q no. Vendras a Barcelona te quiero un besazo wapisimo!!!!!!!!

Object

1725Object23/06/2002 05:17:25

esto para que estes mas orgulloso de tu trabajo: en todos los pub, discotecas, hasta por los coches se escuchan tus canciones. que te parece?? me alegro mucho de tu exitazo y esperemos que siga mucho tiempo. Suerte! *patri*

Object

1726Object23/06/2002 05:17:35

¿David cuando te dijeron que eras el tercer finalista te lo creiste o creias que era un sueño?¿cuando te emocionas porque no lloras, te da verguenza?¿te gustaria salir con Gisela, o otra chica de la academia?muchos besos, Ana Elisabeth, Madrid.

Object

1727Object23/06/2002 05:17:55

ya que no vas a dar un concierto en Tenerife, con lo cual estoy un poco triste, ¿vendrás por lo menos a firmar discos?. Por favor, te lo pide tu fans nº1, Marta.

Object

1728Object23/06/2002 05:18:49

Hola David, soy una gran fan tuya. Digas la verdad a parte de buena compañera y amiga gisela es algo más? es que soy fan de los dos, y me encantaría que hacierais un concierto los dos juntos aqui en cataluña, no te gustaría hacerlo con gisela los conciertos? Mucha suerte y que tengas tanta suerte en todos los discos que vales mucho. Elisabet.

Object

1729Object23/06/2002 05:19:50

hola soy Maria de sevilla y queria saber si te da miedo que con la segunda edición de OT paseis a un segundo plano y tu carrera de artista llegue al final. yo espero que eso no pase te apoyare siempre yo y mucha mas gente te quiere tu amiga

Object

1730Object23/06/2002 05:19:53

En tu proximo disco ( aunque todavia os queda mucho por empezar a hacerlo ) haras algun duo con alguna chicoa de o.t. ? hacemos una revista y te querriamos hacer una entrevista contacta con l13c19r@hotmail.com porfavor te lo ruego . Besos

Object

1731Object23/06/2002 05:19:57

¡¡Hola Busta!! Komo te va todo?? Primero quiero decirtes k eres un tio guapissimo i k kantas super bien. Mi pregunta es..... ¿ Sabrías decir una canción con la que te sientes muy identificado? Bueno, un besazo y.... ¡ A TRIUNFAR!.

Object

1732Object23/06/2002 05:20:39

Hola Busta eres un chico corriente,eres un chico normal,pero no se lo tienes que no te puedo olvidar.Mis preguntas son¿Yo soy de Tenerife y me gustaria saber q tal te parecio la isla?Y la otra q x q no vienes aki de gira o a firmar los discos con las ganas q tenia de q vinieras?Mas nada y q sepas q eres el MEJOR!!!Y q siempre lo sera wapeton no cambies!!!Un fuerte abrazo y un besazo de tu fan 1º Melisa.Besos wapo!!!

Object

1733Object23/06/2002 05:20:59

Hola Bustamante me llamo Sandra Arranz Martinez tu disco inmejorable no me canso de oirlo oye e mirado y llmado a todas partes y como q no vienes a Barcelona almenos eso popne y estoy muy triste vas a venir?????? no se si te acordaras de mi me firmaste la camiseta en el aeropueto de bcn muxas gracias y haber si te veo algun dia puesto el collar q te regale de la pluma te quiero un besazo wapisimo

Object

1734Object23/06/2002 05:21:34

después de ir a operación triunfo, ¿siques llevando la misma vida en S. Vicente de la Barquera?

Object

1735Object23/06/2002 05:21:34

hola soy Maria una fan sevillana a la que le encantas y queria saber si vas a venir por aki y cuando. Muchos besos

Object

1736Object23/06/2002 05:23:01

dices que no estás con Gisela,por que no lo quereis admitir? iria 14 madrid

Object

1737Object23/06/2002 05:24:37

después del paso por la academia de operación triunfo¿sigues llevando la misma vida en s Vicente de la Barquera? iria 14 madrid

Object

1738Object23/06/2002 05:25:58

¿Qué cosas echas de menos de tu vida anterior? ¿Has cogido alguna "manía" o "superstición" de ser artista? ¿Qué te aportamos tus fans en tu nueva vida, qué significamos para ti? ¿Te hemos enseñado algo? Marta. (Rivas Vaciamadrid)

Object

1739Object23/06/2002 05:29:40

Hola Pedazo de artistazo!! Soy Elisabet de Barcelona, ante todo darte la enhorabuena por el éxito que has conseguido, considero que eres de las mejores voces que entró en la academia, pero ¿no tienes miedo de perder el éxito con la misma rapidez que lo conseguiste? Ojalá que no!! Un besazo, y no cambies nunca :*.

Object

1740Object23/06/2002 05:32:29

mi David Bstamante, también llamado "Busta"por sus fans y gente q le quiere,(es decir, todo el mundo)has sido, eres y seras siempre mi favorito y mi nuevo ídolo.....pero ¿como haces para ser tan guapo, cantar como nunca había escuchado, tener esa facilidad de palabra y ademas ser la caña, es decir, tener ese sentido del humor q tanto admiramos de ti? eh?tienes q explicarme cual es la receta para ser tan perfecto como eres tu, esq mi amor lo tienes todo!!!!!te admiraba mucho cuando estabas en el programa, pero esq ahora q ha "nacido tu hijo" llamado tambien "Bustamante"te admiro el doble, te quiero y espero q un dia nos veamos(ya me gustaria) y me puedas contestar a todas estas preguntas y me puedas dar tu receta(entre tu y yo eh?). BabyVigo15

Object

1741Object23/06/2002 05:36:41

¿TIENESGANAS DE EMPEZAR LA GIRA DE TU PRIMER DISCO? ¿ESTAS CONTENTO DE REALIZARLA CON VERÓNICA? UN BESO(MAROBI,GRANADA)

Object

1742Object23/06/2002 05:37:48

BUSTA, TE ESCRIBO DESDE URUGUAY... QUIERO SABER SI TENES PENSADO HACER UNA GIRA POR SUDAMERICA, ESPECIALMENTE POR AQUI... TE QUIERO MUCHO, SOS UNA GRAN INSPIRACION PARA MI. UN BESOTE ENORME CAROLINA.B (MONTEVIDEO, URUGUAY)

Object

1743Object23/06/2002 05:39:50

Hola David eres el mejor soy tu fans nº1 que has sentido despues de todo lo que te ha ocurrido? Despues de la gira y tu triunfo como ha sido?bueno mucha suerte y arriba busta!!! ERES EL MEJOR te quiero guapoooooo.Tu disco esta muy bien me encanta un saludo y un besaso de tu mejor fan sarai arriba bustaaaaaaaaa

Object

1744Object23/06/2002 05:41:24

Bustamante disco de diamantes!! que se sabe de eso? no nos informan! segurisimo que ya lo has conseguido. Nos puedes decir algo? hasta siempre, tu foro.

Object

1745Object23/06/2002 05:41:54

Hola David!!!! Soy una de tus fans, y me alegro por como te esta yendo todo, espero que tengas mucha mas suerte y consigas el Disco de Diamante!!!Cómo estas viviendo este gran Boom??A parte de con Vero,te gustaria hacer bolos en verano con otros compañeros? Muchos Besos: Yolanda M.M (Barcelona) Pst:Por qué no haces ningun bolo en pueblos mas cercanos a Barcelona?

Object

1746Object23/06/2002 05:42:16

Hola Busta soy Cristina de Alicante el dia del concierto de Elche fuimos una amiga y yo.Nos entrevistaron en radio Elche y me gustaria saber si oiste nuestra entrevista. Por si no la oiste que sepas que tu y todos estais invitados a venir a las fiestas de mi pueblo MUTXAMEL que como tu dices de San Vicente de la Barquera tambien es el mejor ja,ja.Bueno ¿te animas a venir en septiembre? Ah y que sepas que eres un chico muy guapo y que si estas con Gisela muchisima suerte.BESOS TE ESPERAMOS GUAPETON.

Object

1747Object23/06/2002 05:44:52

Hola Busta, me gustaría que me dijeses si vas a hacer un concierto en Huesca, me muero de ganas por conocerte. Adios guapo

Object

1748Object23/06/2002 05:46:38

David ahora que eres famoso no te olvidaras nunka de donde vienes y de tus raices ¿no?,eres el mejor no cambies nunka sigue siendo asi un beso muy grande de una cantabra.

Object

1749Object23/06/2002 05:46:48

xxxxxxxxxx

Object

1750Object23/06/2002 05:47:43

Hola David, cómo te has sentido después de Operación Triunfo y cómo ha cambiado tu vida después de de éste???

Object

1751Object23/06/2002 05:48:05

Tienes novia???

Object

1752Object23/06/2002 05:48:54

¿eres tan divertido en la vida real como en la academia junto a alex ? laura (bcn ) hago una revista te quiero hacer una entrevista la dir. la he dicho antes pero es q tengo muchas ganas de entrevistarte ¡guapo! mi dir . l13c19r@hotmail.com

Object

1753Object23/06/2002 05:49:50

Soy una fan de Panamá, y la verdad que tu estancia en la Academia no me la he perdido, te felicito por ser tan buen amigo de Alex, eso dice muchísimo de tu persona, con él hasta el final, quisiera saber si en tus proyesto esta el venir a mi país, y si es así dime cuándo me encantaría verte en persona.

Object

1754Object23/06/2002 05:50:30

Hola, me llamo María y tengo 15 años. Me gustaria saber ¿qué es lo que más te agrada de ser cantante y lo que menos te gusta? ¿cómo me puedo hacer de tu club de fans? y si seria posible ampliar tu gira ya que me gusataria que pasaras por Guadalajara para poder verte. Besos. Una seguidora.

Object

1755Object23/06/2002 05:51:05

Bustamante,¿Qué sentistes cuando actuastes en el Bernabeu con tanta gente y ademas de ser uno de los más aclamados por el publico?por cierto sigue asi y no cambies nunca eres el mejor,guapisimo.Cris(madrid)

Object

1756Object23/06/2002 05:51:14

BUSTA ¿ESTAS CON GISELA?

Object

1757Object23/06/2002 05:53:58

BUSTA ¿ESTAS CON GISELA ?

Object

1758Object23/06/2002 05:54:49

hola guapo nos podrias decir cuantos discos llevas vendidos? gracias guapisimo

Object

1759Object23/06/2002 05:56:34

Se comenta una pequeña rivalidad entre bisbal y tú profesionalmente.¿Qué opinas sobre ello? Mucha suerte compañero!!

Object

1760Object23/06/2002 05:57:16

¿bustamante es verdad que antes te gustaba gisela? y si no ¿porque os disteis un beso en el principio del concurso ? dime la verdad por favor

Object

1761Object23/06/2002 05:58:51

hola wapo! que ta ha parecido el resultado de tu disco? se ha vendido como pipas, y no es de extrañar, es una autentica maravilla!!

Object

1762Object23/06/2002 06:01:42

Con todo este tragin de giras y demas no tienes tiempo para estar con los tuyos. Cuando te tomaras un respiro? espero que sigas teniendo todo el exito visto hasta ahora. Alicante siempre contigo.

Object

1763Object23/06/2002 06:03:21

Con el exito de tu disco en España, teneis pensado promocionarlo en otros paises? te esperamos en tu foro. Muchos besos.

Object

1764Object23/06/2002 06:04:27

hola soy una boliviana, y me gusta como cantas, me llamo zulema , vivo en Lerida. quiero saber si vendras a lerida en consierto

Object

1765Object23/06/2002 06:05:43

hola David.Quiero felicitarte por ese maravilloso disco y decirte que te mereces lo mejor del mundo y que siempre te apoyaremos,y mi pregunta es¿Que tal llevas lo de ser famoso?.PATRI(VALENCIA)

Object

1766Object23/06/2002 06:07:43

una pregunta un tanto comprometida: con quien de los 16 te quedarias? mojate y contestanos! :) muchos besitos,como tu dices dulces y traviesos.

Object

1767Object23/06/2002 06:09:20

hola david, soy una fan incondicional tuya y me gustaria preguntarte un cosilla. ¿que sentiste la primera vez que te nominaron en la academia?.besos.tamy, aviles-asturias

Object

1768Object23/06/2002 06:09:25

muy buenas titin!! que te parecieron las votaciones de Eurovision? bueno,no nos quedamos los primeros pero tampoco los ultimos... Sois los mejores!

Object

1769Object23/06/2002 06:12:18

hola busta!!!, ¿que sentiste la primera vez que te nominaron en la acdemia?. besos de tu fan numero 1 asturiana. te quiero

Object

1770Object23/06/2002 06:13:46

Enhorabuena David por tu primer disco, es fabuloso, me encanta, me gusta tanto que no paro de escucharlo y cada vez me gusta más. ¿Qué sientes cuando escuchas todos los halagos que te dedicamos, te lo crees?

Object

1771Object23/06/2002 06:15:20

HOLA dAVID , ANTE QUE TODO FELICITACIONES, POR LLEGAR A DONDE ESTAS, TE LO MERECES, ME LLAMO pATO, VIVIO EN LA PATAGONIA ARGENTINA, Y MIRE TODO EL PROGRAMA, ? COMO SE HACE PARA SOBRELLEVAR LA VIDA DE CANTANTE A LA VIDA SEDENTARIA POR ASI LLAMARLO QUE TENIAS EN LA BARQUERA. gRACIA. te AMooooo.Pato

Object

1772Object23/06/2002 06:15:36

Hola David, ¡felicidades por ese pedazo de disco!.¿Qué ha pasado con tu anterior manager, la que te acompañaba cuando la grabación de las voces de referencia?

Object

1773Object23/06/2002 06:19:50

Tenes tiempo, para dedicarle a tu familia, o te dedicas a lleno a esta nueva vida? Tenes pensado sacar tu propio disco y traspasar las barreras hacia el mercado latino????? Es cierto cuando se dice que el ser famoso se te suben un par de pajaritos a la cabezza o seguis siendo igual??? Haces terapia???

Object

1774Object23/06/2002 06:21:03

hola david soy una chica de Granada y una admiradora nata tuya.Me gustaria saber si vendras aki a algun concierto ya k mire en muchos sitios y aki no aparece Granada lo cual a muchas nos encantaria lo haras????nun besazo guapisimo

Object

1775Object23/06/2002 06:24:28

busta, solo te quiero preguntar que le das a la gente que tanto te quiere, pero que quede claro que si por ti tengo que morir que viva la vida eterna

Object

1776Object23/06/2002 06:24:31

HOLA SOY UNA FAN MEXICANA Y NO PUEDO COMPRAR SUS DISCOS DESDE AQUI, ASI QUE: ¿ VISITARAS MEXICO? BYE.

Object

1777Object23/06/2002 06:25:06

HABER DAVID, NOS PUEDES DECIR CUANTO SERA EL TIEMPO Q TU ESTES EN EL ESCENARIO(HABLO DE TU GIRA EN SOLITARIO)SIN VERO?TQM GUAPO.LINARES

Object

1778Object23/06/2002 06:26:02

HOLA GUAPO, ESTAS CONTENTO CON LA IRA Q VAS HACER O TE GUSTARIA HABER IDO A MAS LUGARES?HAS DECIDIDO TU LOS LUGARES?

Object

1779Object23/06/2002 06:26:37

¿¿qué es lo que nos das para que te apoyemos tu club de fans sin condiciones y te queramos tanto??blanca colmena (d sevilla)

Object

1780Object23/06/2002 06:27:03

PRECIOSO CUAL SERA TU PROXIMO SINGLE?estaria mu bien q fuera EL airE q Me DaS.UN BESO DESDE LiNarES De AlgUIeN q TqM.

Object

1781Object23/06/2002 06:30:52

¿que es lo que pasa por tu mente cuando ves a una fan tuya llorando por verte o por conseguir un autografo , un beso, tocarte...? :-) rocy0(murcia)

Object

1782Object23/06/2002 06:32:03

Hola soy Débora Calero de Las Palmas me gustaria preguntar a David Bustamante que es lo menos que le gusta de ir de gira. Y a ver si podré conocerle el 27 de julio.

Object

1783Object23/06/2002 06:32:13

¿CREES QUE TE HAS GANADO TODA ESTA FAMA?

Object

1784Object23/06/2002 06:34:27

David quando vendras a sabadell a firmar discos?

Object

1785Object23/06/2002 06:35:08

Hola David!Soy Raquel de Vigo.Soy una fan tuya desde el primer dia q te he visto.De verdad,eres el mejor,tu dulzura,tu sensibilidad,tu simpatía es lo q más llega de ti a parte de tu prodigiosa voz.Mi pregunta es si crees q la fama te cambiará de alguna manera.Te quiero muchísimo.Nunca nadie m hizo llorar,reir,soñar como contigo lo he hecho.Sigue así campeón!Muchos besos!Te veré en julio aquí,no faltaré.

Object

1786Object23/06/2002 06:38:10

El día 16 de Julio donde tienes el concierto en Pola de Siero o en Oviedo. Soy una asturiana con muchas ganas de conocerte. Tu disco es muy bueno y tu eres encantador.

Object

1787Object23/06/2002 06:38:19

Ola david bustamante ,me gustaria que me respondieras a esta pregunta ¿ que les das a las mujeres para que esten coladitas por ti ? AAAAHHH"!! y que tu disco es el mejor , me gusta mucho como cantas ¡¡¡ ANIMO QUE LLEGARAS MUYYYY LEJOS!!!!! Y aquela gala que hicieron para ti estuvo muy chula!!!! Ala ! uno que se despide y un fuerte abrazo!!! Deuuuuuuuuuuuuu ( ERES EL MEJOR )

Object

1788Object23/06/2002 06:42:44

Agora que és um artista e uma pessoa importante, achas que a tua personalidade irá mudar em algum aspecto?

Object

1789Object23/06/2002 06:44:00

hola Busta guapeton, desde Las Palmas te queremos agradecer lo bien que te portaste aunque no pude firmar mi disco me lo pase muy bien ¿ qué te parecimos la gente de aquí ?

Object

1790Object23/06/2002 06:44:21

Hola Busta, me llamo Elisa soy de Mallorca. ¿Sabes que tu disco es genial? me encanta. ¿ Me podrías decir cuando vienes a firmar los discos a Mallorca? te deseo lo mejor. Sigue asi de simpático.

Object

1791Object23/06/2002 06:44:23

Hola David.¿Con cuál de tus canciones te indentificarías más? Besos, sigue así y nunca cambies. Una onubense que te quiere y nunca se olvidará de ti.

Object

1792Object23/06/2002 06:44:23

David,no queremos preguntarte nada,solo queremos que sepas que contaras siempre con nuestro apoyo que sigas trabajando y estudiando que sigas disfrutando con tu musica que no cambies dentro de lo que buenamente puedas que cuando te encuentres bajo(que te pasara) recuerdes tu Cantabria,nuestra Cantabria,tu Sanvi que es lo que te da la fuerza y no dejes de soñar nunca. Desde Cantabria con muchísimo cariño Apa titin

Object

1793Object23/06/2002 06:44:32

querria saber las fechas de los conciertos ya que me he comunicado con el club de fans y no he obenido respuesta espero que me la des tu guapeton.

Object

1794Object23/06/2002 06:44:33

Array

Object

1795Object23/06/2002 06:44:54

¿¿¿qué sientes cuando suceden tantos desastres en tu tierra debido a la accion de ETA ahora que tu n estas alli???un beso,TE KIERO.blanca

Object

1796Object23/06/2002 06:45:55

Hola Busty.¿Qué tal?¿Qué es lo que más echas de menos de tu vida antes de Operación Triunfo?Tu admiradora número uno.

Object

1797Object23/06/2002 06:48:26

Hola Titin.¿Cómo te sientes al saber que has vendido ya mas de 700.000 copias? Tu CD es magnífico.Hasta siempre. Una almeriense que te admira.

Object

1798Object23/06/2002 06:51:17

Array

Object

1799Object23/06/2002 06:51:43

Hello David.¿Qué sentiste al saber que eras el número uno en ventas?Si quieres contestarme personalmente mi móvil es 606225596.Te quiero. Una madrileña.

Object

1800Object23/06/2002 06:52:09

¿te cae bien BISBAL?

Object

1801Object23/06/2002 06:53:49

YO SOY DE LAS PALMAS TE ACUERDAS CUANDO FUISTES A FIRMAR DISCOS YO ESTUVE AYI NO ME FIRMASTES EL DISCO PERO TENGO FOTOS TUYA LA PREGUNTA¿DESPUES DEL CONCIERTO YDE LA FIRMASDE DISCOS VOLVISTES A SAN VICENTE DE LA VARQUERA?¿ALGUNA VEZ TE AN DICHO QUE TIENES UNA SONRISA PRECIOSA?PUESLA TIENES GUAPO

Object

1802Object23/06/2002 06:55:04

que haces para estar tan bueno?????

Object

1803Object23/06/2002 06:56:25

Hola David: ¿cúal ha sido la mayor satisfacción que has tenido con la realización de este disco?, dejáme decirte que me pareces un tipo sensacional al igual que todos tus compañeros de OT, saludos desde Colima, colima, México. Juan José López Peregrina

Object

1804Object23/06/2002 06:56:36

te sentiste bien con el público de mérida??

Object

1805Object23/06/2002 06:57:07

hola david vas a venir a barcelona hacer algun concierto? nos llamamos mary y lorena

Object

1806Object23/06/2002 06:58:42

Hola David somos Nerea y Silvia de Barcelona, cuando vas a venir por aqui a firmar discos? te esperamos pronto!!!muchos besos

Object

1807Object23/06/2002 06:59:36

hoolaaaaaaaaaaaaaaa! soy laura de 15 y miriam de 20 y somos fans numero "1". nos gustaria saber si haras un concierto en barcelona, o algun lugar más cercano y sobre que fechas. ya que nosotras somos de badalona. por cierto eres muy guapo y tu disco es genial. te queremos busta. laura y miriam. besos

Object

1808Object23/06/2002 07:00:09

Hola guapo!!Eres el mejor y espero que sigas asi por mucho tiempo.A ver si logro verte en uno de esos conciertos de tu gira, que fui a 2 de operacion y te vi de lejos. Bueno decirte que tu CD es la bomba y al cancion a duo con Alex el no va mas. Adios y besos. AHHHH y como se soporta eso que de repente uno se haga tan famoso???? Rebe

Object

1809Object23/06/2002 07:00:57

Busta kndo iras a barcelona a firmar tu dico? eres el mejor!!! wapo!

Object

1810Object23/06/2002 07:03:06

¿Cómo te sientes al ser uno de los líderes en ventas, piensas venir a Tenerife a deleitarnos con tu voz?

Object

1811Object23/06/2002 07:04:30

Lo primero que queremos decirte es que tu disco nos vuelve locas y tu mas.Queremos preguntarte pq no das un concierto en Granada.Te seguimos en todos los sitios que apareces.Espero que contestes a nuestra pregunta.Nos harías muy feliz si cantaras aquí.BESOS.Quini,Susana y Loli

Object

1812Object23/06/2002 07:05:51

Hola mi superman David,soy una fans de tu foro en tenerife y me gustaria preguntarte,si voy a tu tierra que me hace mucha ilusión,se podrá conocer a tus padres y ver la casa donde estuvistes viviendo todos estos años??muchisimas gracias y recuerda que DE CANARIAS A SAN VICENTE DE LA BARQUERA TE QUIERE ESPAÑA ENTERA.Espero que te haya gustado el regalo de todo corazón.Un millóooon de besos y espero verte otra vez.SANDRA.

Object

1813Object23/06/2002 07:08:25

QUISIERA SABER,QUE TENDRIA QUE HACER UNA MUJER PARA GANARSE TU CORAZON?

Object

1814Object23/06/2002 07:11:45

´te gusta gisela' dime la verdad

Object

1815Object23/06/2002 07:11:46

hola busta la gala en tu pueblo molo a tope iras a la de rosa o a la de bisbal?????

Object

1816Object23/06/2002 07:13:08

David en tu disco hay temas muy distintos, ¿tu crees que, el haya varios compositores, le da mas variedad al cd.? Lucia.

Object

1817Object23/06/2002 07:13:17

david, explicame diferencias entre las personas de cantabria y las catalanas. me encanta tu disco .likeone.

Object

1818Object23/06/2002 07:13:42

Hola David, ahora que ya no tienes la disciplina de la academia y eres tú quien decide lo que has de hacer, ¿has cambiado los hábitos que allí adquiriste, me refiero a hábitos de trabajo, descanso, dietas, salud? La imagen que allí se mostraba era sana, de limpieza, ¿es así el mundo real del artista?

Object

1819Object23/06/2002 07:13:43

Hola!!Preguntita para el lindo y talentoso Bustamante,Bueno soy de Puerto Rico y vivo en la Rep.Dominicana mi pregunta es:¿Que es lo mas te gusta de una mujer tanto fisica como interiormente, en que es lo primero que te fijas a la hora de elgir a tu pareja? ATT:Ivanova Rodriguez.

Object

1820Object23/06/2002 07:14:22

porqtodos los cantantes contais al amor y cuando la gente cree q os abeis enamorado lo rechazais tan facilmente?no crees q el amor es algo maravilloso de lo q no se debe avergonzar nadie? prq gisela y tu no decis la verdad sobre lo q hubo? lo vimos todos.UN BESAZO ENORME PARA EL CANTABRO MAS GUAPO Y MEJOR PERSOINA DEL UNIVERSO AKI TIENES UNA FAN PAMPLONICA Q NO TE OLVIDARA JAMAS. NO CAMBIES ERES EL MEJOR BUSTA TO THE POWER BESOS ELBA (Pamplona)

Object

1821Object23/06/2002 07:16:00

porq eres tan cabron

Object

1822Object23/06/2002 07:16:02

david.estas preparado, para afrontar tu futuro, sea exitoso, o no lo sea. porque tan peligroso es lo uno o lo otro.espero que tengas buenas personas a tu lado que te quieran. likeone

Object

1823Object23/06/2002 07:16:26

Hola David ya q me temo q este verano nos haremos media gira contigo cuentanos un poco q nos vamos a encontrar en esos conciertos. Eres el mejor. un beso del comando Catalán (Marta, Jessy y Tania)

Object

1824Object23/06/2002 07:16:50

Hola David querìa saber como te sentias cuando a pesar de todas las nominaciones te salvavas llegando incluso a ser el 3ºfinalista.Ademas el conseguir el record de ventas en menos tiempo. Te quiere Noe_Granada

Object

1825Object23/06/2002 07:17:25

eres un cabron hijoputa

Object

1826Object23/06/2002 07:17:34

Hola David ¿Con que cancion de las de tu disco te identificas mas?

Object

1827Object23/06/2002 07:18:51

¡¡¡hola pedazo de cantabro!!!Felicidades por todo. A mi tu disco me encanta, y me imagino que a ti tambien porque es tu "niño", pero ¿por cual canción luchaste más para que se incluyera en el cd? Nos vemos pronto. Besos, te quiero. Marta

Object

1828Object23/06/2002 07:18:59

David,¿no te da miedo que algunas personas que te rodean se puedan aprovechar de ti por tu juventud e ingenuidad? ¿Qué piensas hacer para evitarlo? Un beso muy grande y felicidades por tu éxito. Te lo mereces. Te vi el sábado en Las Palmas y estuviste genial. Carmen (Tenerife)

Object

1829Object23/06/2002 07:19:53

Hola David!! ¿Quería saber qué es lo que menos te gusta de tí? Jaja!! A mí nada. Besos Inma (Granada)

Object

1830Object23/06/2002 07:20:25

Hola guapísimo,soy Sonia y yo quería preguntarte si te propusieron hacer algún otro dueto con otro compañero de la academia que no fuera Gisela ni Álex.Me encanta tu disco, para mí eres Disco de Diamante desde el primer dia que pisaste la academia, MUCHOS BESOS!!!, Sonia, Getafe.

Object

1831Object23/06/2002 07:20:31

David,¿que sentiste cuando carlos lozano te dijo que habías vendido mas de 500.000 copias en tan pocos días? te deseo suerte.un beso.

Object

1832Object23/06/2002 07:20:49

david.crees que tu fisico te ha ayudado, a conseguir tu sueño?tienes una gran voz , un beso. likeone.

Object

1833Object23/06/2002 07:21:20

Hola David, Enhorabuena por tu disco !!!es muy completo!!! Me cuesta decidir cual me gusta más. Bueno, mi nombre es Belén tengo 18 años y te escribo desde Almeria. Mi pregunta es: ¿Cómo te sientes por haber subido tan rápido al panorama musical y por estar compitiendo con tus propios idolos? ¿Crees que dicha rapidez es sinónimo de artista efímero? Olé acampeón te mereces todo esto y más!!!Un beso.

Object

1834Object23/06/2002 07:23:12

busta. ¿para cuando tu casa en Barcelona?,como harás para que tus fans no se enteren de donde vives.una admiradora que te quiere. likeone

Object

1835Object23/06/2002 07:24:13

lo primero felicitarte porque eres un gran cantante y una gran persona,te admiro mucho. Ahora estas en la más alto,¿tienes miedo a caerte? y ¿como se lleva eso de no poder salir ni a la puerta de tu casa sin ser reconocido?muchas gracias y sigue asi. De Miriam,de Rivas vaciamadrid

Object

1836Object23/06/2002 07:25:26

David, cuando te enterastes que vale music era tu compañia,cuando ellos habian sido los que varias veces te habian nominado en la academia¿que pensaste?Pedazo de disco el que has sacado. likeone

Object

1837Object23/06/2002 07:26:08

cuando vas a venir a firmar discos a Valencia......un beso eres el mejor.Patri

Object

1838Object23/06/2002 07:26:12

como puedo conseguir el pañuelo

Object

1839Object23/06/2002 07:26:19

A pesar de todo el trabajo que tienes por delante, supongo q te gustará tomarte unos días de vacaciones... ¿Dónde te gustaría? Noelia (Murcia)

Object

1840Object23/06/2002 07:27:48

busta:¿sabes yó habia olvidado la música, ella no tenía siginicado para mí, hasta que te conoci, desde entonces, la radio o el disman siempre va conmigo.¿que sientes cuando oyes cosas como estas?un beso. likeone.

Object

1841Object23/06/2002 07:29:02

Hola busta ¿Sabes si vas a venir a Toro el día 23 de agosto? Es al unico sitio que puedo ir a verte. res el mejor del mundo

Object

1842Object23/06/2002 07:31:35

hola Bustamante.¿con las chapas del club oficial podemos entra en tu camerino el dia del concierto en G.C?

Object

1843Object23/06/2002 07:35:32

¿Como t ha sentado la fama?¿Por q tanta popularidad a Cantabria,ya q tus compañeros no han hecho tanta popularidada a sus ciudades? se t a relacionado mucho con Gisela por q?

Object

1844Object23/06/2002 07:36:49

A la gente le gusta mucho tu disco a mi especialmete, supongo que estaras contento por los resultados que estas obteniendo, ¿ por que no te dan ya el disco de diamante si ya se dice qu has superado el millon de copias?un beso, mucha suerte, y me encanta tu disco, es uno de los pocos que gustann enteros. UNA FAN DE VALENCIA.

Object

1845Object23/06/2002 07:36:49

¿que tal llevas esto de la fama?Yo se que que lo que ahora estas haciendo es lo que realmente te gusta, pero tambien tiene que ser duro no poder estar con tu familia todo el tiempo que quieras o con tus amigos tranquilamente en la playa o en el pub que frecuentabas de antes,(ya ves que sigo tu trayectoria paso a paso).De Cristina(Santander)Nick:Aupa-Busta.Besos dulces y traviesos,David.

Object

1846Object23/06/2002 07:37:23

estamos contigo titin ese bañador te vi en la playa el otro dia apaaa,solo quiero decirte qeue no se te suba nada a la cabeza por que te aseguro que todo lo que tines se te iria a la mierda un besazooo S.V.B

Object

1847Object23/06/2002 07:39:01

¿Cómo se lleva eso de que tus fans te sigan a todas partes? ¿que fue lo que te inspiró a llamar a operacion triunfo? ;)

Object

1848Object23/06/2002 07:39:35

Cuando hagas tu proximo disco, ¿vas a seguir con Miguel Gallardo?. Espero que sea igual o mejor que este, porque este es BUENÍSIMO. No cambies; te "adoro". Besos Guapeton!!!!!! Marta

Object

1849Object23/06/2002 07:41:20

Hola David!! soy de tu tierruca y me gustaria saber cuando es la firma de discos aquí, en Cantabria.estuve en la primera que hiciste el C.I y fue estupenda.Ánimo y que se te quiere mucho, Muchisima suerte con el fantástico disco que tienes.Cristina(Santander).Nick:Aupa-busta.

Object

1850Object23/06/2002 07:41:33

como cres que estaran los otros cantantes? despues de la fama que se ha dado en este programa, ahora namas se piensa en operacion triunfo. y los otros cantantes ya estan mas apartados. pero pienso que eso somos nosotros pq nos gustan las canciones es la moda y soys geniales, asi que nada seguir con esto "eres el mejor"

Object

1851Object23/06/2002 07:42:12

hola me gustaria preguntarte que ha pasado con la cancion que te ha compuesto marcos llunas, tambien queria decirte que eres el mejor y que tu disco es impresionante no me esperaba menos de ti ¡¡¡¡ARTISTAZO!!!!. LORENA 12 AÑOS CASTELLON

Object

1852Object23/06/2002 07:42:35

Hola David, me llamo Sara, soy una chica de Madrid de 21 años y quería saber si la gira ya está cerrada o va a haber algún concierto más. Supongo que estarás contento por hacer la mayoría de la gira con Vero porque es genial, pero cuál es la razón para que la hagais juntos y porqué con ella(es que soy muy cotilla). Fui al concierto del Bernabeu ( impresionaba eh?), pero me encantaría verte algún dia de cerca y poder hablar contigo, pero ya no sirvo para batallas de fans!Solo decirte que eres un cielo, me encanta tu disco, tu voz y sobre todo tu forma de ser,no cambies nunca.Un beso.Sara.

Object

1853Object23/06/2002 07:43:03

hola, me gustaria si vas a venir a promocionar tu disco, a una gira o simplemente a pasear a Venezuela... bye.. Besos

Object

1854Object23/06/2002 07:43:12

te doy un consejo, en el otro disco que saques desnudate por completo que se te vea todo, y venderas el doble, pq cantas muy bien y pq estas buenisimo.

Object

1855Object23/06/2002 07:43:15

¿Alguna vez pirateaste un disco?Rosa Pulleiro

Object

1856Object23/06/2002 07:43:45

¿Cuales fueron tus deseos en la noche De San Juan? Rosa Pulleiro.

Object

1857Object23/06/2002 07:43:57

se comenta que hay una cierta ribalidad entre tu y bisbal por vuestros discos ¿es eso cierto?

Object

1858Object23/06/2002 07:44:36

¿Cual seria tu mayor ilusion? Rosa Pulleiro

Object

1859Object23/06/2002 07:44:58

¿Cual fue tu mejor momento dentro de la academia? Rosa P.

Object

1860Object23/06/2002 07:46:14

Hola! soy de venezuela,realmente por aqui son muy escuchados bueno no tanto como alla si tuvieras la oprtunidad de presentarte aqui lo harias? y para cuando lo pensarias?

Object

1861Object23/06/2002 07:48:58

hola david,vas a venir a firmar discos a valencia?un besazo campeon.eres el mejor.no cambies nunca.

Object

1862Object23/06/2002 07:49:26

¿con cual canción de tu disco te identificas más? Yo solo tengo 13 años, no es que tenga mucho conocimiento de la música, pero, tu disco te pega, y yo creo que es tu estilo ¿ que piensas tu? Iré a verte a Cabra, nos vemos por allí!! Mi hermana de 7 años dice que te quiere.Marta y Celia. BESOS.

Object

1863Object23/06/2002 07:51:08

Hola wapetón!Mi pregunta es si en un futuro, cuando tengas ya tus hijos, te gustaría que alguno de ellos se dedicara también al mundo de la música."Una velanciana"(que tiene entrada para el 10 de julio verte!)

Object

1864Object23/06/2002 07:51:58

Hola Guapo. Soy una chica de Zaragoza y me llamo Maria,te quiero desear mucha suerte en tu gira y que sigas como hasta ahora.Mi pregunta es:tu que piesnsas que un cantante nace o se hace? Muchos Besos y Animo

Object

1865Object23/06/2002 07:53:50

hola busti.Le gustas a toda mi familia.Mi hermana y yo estamos loquitas por ti tenemos fotos el disco...un saludo a todos tus compañeros y en especial a rosa que los dos con gisela es decir los tres sois los mejores.Un beso muy fuerte.

Object

1866Object23/06/2002 07:54:03

EN VENEZUELA MUCHAS PERSONAS TE CONOCEN GRACIAS S LA TELEVISION POR CABLE Y TE QUIEREN, O TE QUEREMOS, MIPREGUNTA ES SI VAS A PROMOCIONAR TU DISCO EN VENEZUELA PRONTO?

Object

1867Object23/06/2002 07:54:29

qe sepas qe eres el mejor!! vas a venir este verano a melilla?

Object

1868Object23/06/2002 07:55:04

Hola guapetón! tu q eres un futbolero, q te ha parecido el mundial?? Un besico, Mariapi de Zaragoza. Ole maños, olé

Object

1869Object23/06/2002 07:57:26

Hey campeón, ¿cómo llevas eso de ser famoso y que todo el mundo te conozca? no cambies nunca y cuídate q t kda mucha carrera x delante,MUCHOS BESOS, Sonia,16. Madrid.

Object

1870Object23/06/2002 07:57:30

Bustamante para mi eres el mejor y t quiero muxo pero a mi me gustaria ke estubieras "liado" con GISELA ESPERO KE SI ¿LO ESTAS? AH KE SEPAS KE ESTAS MUY BUENO Y GISELA ES MUY GUAPA Y HACÉIS MUY BUENA PAREJA Y KE YA ME GUSTARIA ESTAR EN EL LUGAR DE GISELA Y PODER ESTAR CONTIGO. TE KIERE TU FAN Nº 1 . CÁNCER

Object

1871Object23/06/2002 07:57:31

¿guapetón no estas mal pa mi pero m gustaria que te pusieras con gisela

Object

1872Object23/06/2002 07:58:35

¿que a sido lo más grande que has hecho por tu ídolo? Tu eres el mio, y el mejor. Tu fan número 1

Object

1873Object23/06/2002 07:59:11

Soy una de las muchas chicas que ya tienen entradas para tu concierto con Verónica.Mi pregunta es: ¿qué os llevó a ti y a Vero a realizar gran parte de vuestra gira juntos?¿En el concierto cada uno presentará en solitario su disco aunque luego canteis alguna cancioncilla juntos?Un besazo guapetón y te espero el 10 de julio en Valencia!

Object

1874Object23/06/2002 07:59:42

El día 19 de Agosto cuando vallas con Veronica a Paterna ¿donde actuareis?

Object

1875Object23/06/2002 08:00:09

Hola David soy una niña de pamplona de 9 años y me gustaria preguntarte cuando pasaras por aqui en concierto.

Object

1876Object23/06/2002 08:01:53

hola busta, como estas, espero que muy bien con este exito. te cuento que me llamo sofia, tengo 20 años y me estoy comunicando desde Uruguay (america del sur), por suerte aqui tienes mucho exito ya que te ganastes nuestro cariño con tu linda forma de ser y con lo hermoso que cantas . Ademas de que yo soy una gran fan tuyo y que desde lejos te sigo, aqui eres muy querido,todavia tengo la esperanza que algun dia puedas venir a cantar por aca, seria un sueño.bueno voy directo a mi pregunta, porque podria seguir hablando, y tal vez escriba tanto que no lo puedas leer: ¿Cuales son tus proximos planes, digo, piensas hacer alguna gira fuera de españa, para que otros paises puedan disfrutar tus canciones? bueno muchas gracias por tu tiempo, te deeo muchos exitos , y que puedas disfrutar todo lo que estas viviendo que debe ser muy lindo poder cumplir tus sueños. un beso muy grande pra ti y a toda españa. ademas de paso te dejo mi e-mail por si lees esto , me encantaria, si me podrias responder, o escribir algo, yo se que no tienes mucho tiempo, pero para mi seria muy importante, ya que no tengo otro medio de comunicarme , porque estoy un poco lejos de España.el mail es Chofi4@elsitio.com desde ya un millon de gracias

Object

1877Object23/06/2002 08:01:56

hola Busta¿en tu gira en solitario vas a pasar por Donosti?(draisy) mi direccion:mery_x_ti@hotmail.com

Object

1878Object23/06/2002 08:01:58

¿Cual fue la cosa más singular que te ha pasado en esta pasada gira con tus compañeros de Operación Triunfo?

Object

1879Object23/06/2002 08:04:27

Hola Busta, yo queria saber si vas a realizar una gira por latinoamerica especificamente Ecuador, porque mucha gente te ha seguido a traves del canal internacional y queremos verte muy pronto por ahi. Felicitaciones por tu nuevo disco y sigue asi 1 besazo. Erika

Object

1880Object23/06/2002 08:04:29

Hola. Soy Margarita Calvo y soy de Barcelona y me gustaría preguntar a Bustamante que ¿cual fue la cosa más singular que le haya ocurrido en esta pasada gira con sus compañeros de Operación Triunfo?

Object

1881Object23/06/2002 08:04:49

Soy blanca de gijón, lo primero que te quiero decir es que aquí te apoyamos mucho, te consideramos mitad asturiano mitad cántabro. Y quisiera preguntarte dónde harás el concierto: en Oviedo o en Pola de Siero? y cuándo vendrás a firmar discos. Un besazo, compañeru

Object

1882Object23/06/2002 08:07:52

Hola Titin!Tu eras un chico de pueblo normal y corriente y despues de operacion triunfo tienes millones de fans¿te gusta que te quieran tanto tantas personas?Te quiero demasiado para yo no ser nadie. un besazo y ole mi pejin.JUDIT MARTINEZ, Abrera (Barcelona)

Object

1883Object23/06/2002 08:10:00

Hola.¿Porque tu gira la harás con Vero?¿La has elegido tú como acompañante o simplemente te ha tocado?¿Crees que hay mucha competitividad entre tú y Bisbal?Tu disco está muy bien.Felicidades. Laura de Logroño(La Rioja)

Object

1884Object23/06/2002 08:10:05

Hola Busta!soy Estefanía una gran fan tuya como habrán muchas,se que tu vida ha cambiado mucho desde que entraste en Operación Triunfo y que has conocido a mucha gente desde entonces,pero,¿no hechas de menos tu vida de antes?,es decir,¿no hechas de menos pasar más tiempo con tus amigos de toda la vida?,para mi mis amigos son muy importantes y me sería muy difícil dejar de verlos al tener que viajar tanto,por eso te pregunto si para ti también está resultando tan difícil,al igual que te pasará con la familia.Gracias por hacer sonar tu voz así que tanto nos anima,eres el mejor!

Object

1885Object23/06/2002 08:10:21

Hola david,una pregunta: ¿q sientes cuando estas en el escenario y ves a toda esa gente cantando tus canciones,gritando tu nombre..? un beso muy grande de una malagueña que te quiere.Araceli.

Object

1886Object23/06/2002 08:12:29

HOLA BUSTAMANTE ERES EL MEJOR TENGO MUCHAS GANAS DE CONCERTE TU ERES DE CANTABRIA Y YO SOY DE BILBAO ME VUELVES LOCA TENGO UN TABLERO LLENO DE POSTERS TUYAS Y ME GUSTARIA CONCERTE CADA VEZ QUE TE OIGO POR LA RADIO ME PONGO A LLORAR PENSANDO DE QUE NUNCA PODRE CONOCERTE ESTA SEMANA ME VOY A COMPRAR TU DISCO TU SIGUE ASI QUE ERES EL MEJOR A PARTE DE QUE ERES UN BUEN CANTANTE ERES PRECIOSO TE ESCRIBE ESTA CARTA UNA FAN TUYA BESOS DE JOSUNE.

Object

1887Object23/06/2002 08:13:38

Me gustaria conozerte! Seguramente con el trabajo y eso no podras solo conque me contestes esto a: atorrent07@hotmail.com, estare contenta

Object

1888Object23/06/2002 08:14:40

hola david,¿te has parado alguna vez a pensar que hubiera sido de ti si no te hubieras presentado al programa?ese cambio de vida. un beso de una malagueña que te quiere.besos.Arceli

Object

1889Object23/06/2002 08:15:22

¿PORQUÉ EN TU GIRA EN SOLITARIO AS DECIDIDO HACER UN PARON EN 'LOS ALCÁZARES'?.YO SOY DE LA POCA GENTE QUE HABITA ESTE PUEBLO , Y ESTOY SEGURA DE QUE NOS HARAS MUY FELICES A TODOS

Object

1890Object23/06/2002 08:16:25

bustamante me gustaria alguna vez verte en persona se ke parece ridiculo pero eres un encanto se ke el 27 de julio vienes pa aki si pudiera verte aunke sea 5 min seria un sueño para mi. responde a estas preguntas ¿donde celebraras exactamente el concierto de las palmas? tu humanidad es lo ke mas admiro tqm tu niña siempre itxaso

Object

1891Object23/06/2002 08:17:28

David,¿vas a venir a Jaén a dar un concierto? mi prima, mi hermana y yo somos tus fans nº1!! nos encanta tu disco.Eres el mejor.Sigue siendo como eres.

Object

1892Object23/06/2002 08:17:38

HOLA BUENAS TARDES, MI NOMBRE ES JORGE GONZALEZ, TE ESCRIBO DESDE AGUASCALIENTES, MEXICO. MI PREGUNTA VA EN RELACION DE ¿ CUANDO VENDRAS A ESTE PAIS, YA QUE SE TIENE MUCHA DIFUSION DE LO QUE ES OPERACION TRIUNFO POR ESTAS TIERRAS Y VEMOS CON ALEGRIA EL GRAN TALENTO DE TI Y DE TUS COMPAÑEROS DEL REALITY SHOW ?, CREO SINCERAMENTE QUE SERAS EL PROXIMO BUMM LATINO......GRACIAS Y SALUDOS.....P.D. QUISIERA SABER TU EMAIL...GRACIAS

Object

1893Object23/06/2002 08:17:51

Hola Busta soy una fans de las muchas que tienes.¿te acuerdas el día que te nominaron junto con Alejandro y Naim? pues cuando te vi llorar me distes mucha pena pero a la vez te cogí mania. Y ahora eres mi idolo junto con tus compañeros de la academia Bisbal, Gisela y Chenoa. Yo quisiera preguntarte una cosa me gustaria saber cuando vas a venir a firmar discos a Madrid.Que como tu ya sabes te quiere y te apoya mucho igual que yo.SUERTE CAMPEÓN.Yo creo que tu si eres un superman, eres el superman que todas tus fans deseariamos conocer y por eso te dedico esta poesia: DEL CIELO CAYÓ UN PAÑUELO,BORDADO DE MIL COLORES,Y EN CADA ESQUINA PONÍA: ¡HAY BUSTA DE MIS AMORES! MUCHOS BESOS Y SUERTE EN EL MUNDO DE LA MUSICA PORQUE DE CORAZON QUE TE LO MERECES

Object

1894Object23/06/2002 08:18:02

hola!!!!!!!!!!!estas muy wapo!!!!pk no has sido modelo??aunke tb te sienta bien cantante.(yasmina bcn)

Object

1895Object23/06/2002 08:19:05

Hola David, encantada de conocerte. ¿Tienes alguna anécdota de pequeño con la música? ¿Cómo se te ocurrió dar el paso y presentarte a OT? Un beso y que consigas lo mejor. RSE

Object

1896Object23/06/2002 08:23:31

Yo tengo dos preguntas a las que espero que me contestes.La primera ¿porque elegiste ese single para tu disco? a mi me gustan otras muchas canciones aunque no creo que esa esté mal.Y la segunda cuando te eligieron en este programa,¿creías que ivas a tener esta fama?Bueno yo me llamo marta y mi hermana ana tenemos 12 y 15 años porfavor mandanos un beso y por cierto tengo familia en Cantabria, Guarnizo y todos somos tus fans y lo seguiremos siendo. Manda un saludo a gisela y a rosa y dalas ánimos para que sigan a delante con su disco porque vosotros tres sois los mejores.

Object

1897Object23/06/2002 08:25:21

David, ¿como prefieres que te llamen, David o Bustamante?

Object

1898Object23/06/2002 08:25:33

HOLA BUSTA:ME LLAMO SILVIA Y QUISIERA SABER LOCAMENTE CUANDO VIENES A MI CIUDAD A CANTAR A CASTRO URDIALES. ESPERO QUE ME CONTESTES URGENTEMENTE COMO TU CANCION.HUBIERA ALGUNA MANERA QUE ME FIRMARAS EL DISCO CNDO VENGAS A CASTRO URDIALES,ESTOY DESEANDO CONOCERTE PARA DARTE SOLO DOS BESOS.YA SE QUE RESULTA MUY DIFICIL PERO PUEDE A VER LA POSIBILIDAD SI TE DEJAN.MI PAGINA WEB ES: www.chiri192002@ya.com.contestame si puedes.sin mas se despide una fiel seguidora de mi cantabro preferido.besos sigue asi triunfaras.((( SILVIA)))

Object

1899Object23/06/2002 08:28:21

David, saludos desde Costa Rica, Centroamérica, aquí te seguimos y te queremos mucho ¿qué piensas del éxito que estás consiguiendo fuera de España y de la forma en que nos has tocado el corazón a todas tus fans en el extranjero?¿que nos dirías a todas y todos los que te apoyamos y queremos día con día a pesar de la distancia? Alicia Sandoval, San José, Costa Rica.

Object

1900Object23/06/2002 08:28:36

Hola David soy Verónica desde Ecuador. Tienes una voz preciosa me gustaria que tu disco sea lanzado internacionalmente porque me encantaria tener uno.

Object

1901Object23/06/2002 08:31:15

¿Es verdad que lees los mails que se te mandan a tu direccion? ¿Los lees tu? ¿Los lee alguien? ¿O no los lee nadie?L.G

Object

1902Object23/06/2002 08:32:13

¿Por qué determinados sectores de la crítica nos quieren convencer de que vuestro éxito es menos valioso que el del "resto de los artistas"? Indiscutiblemente OT ha sido un fenómeno de masas pero, personalmente, yo no era seguidora de OT y cuando te escuche por primera vez me quede "enganchada a ti" ¿no es eso lo que debe conseguir un cantante? Un besazo. Isabel Maria

Object

1903Object23/06/2002 08:32:21

Hola David! Me gustaria saber quando vendrás en Radio Mataro (RM 88.7),es que siempre dicen que vienes y siempre es mentira. Por cierto, me llamo Núria. Adiós guapo!

Object

1904Object23/06/2002 08:36:15

hola bustamante soy YAYA de las palmas,la verdad que me quedé muy apenada por que el otro dia en hipercor no me pudiste firmar pero el manager le dí una carpeta con e-mail del club de fans tuyo lo has leido¿? espero qeu si porque lo hice con mucho cariño.

Object

1905Object23/06/2002 08:36:53

Hola me llamo Maria soy de Madrid y tngo 14 años.Soy una verdadera fan de Bustamante,me gusta su persona y su voz es increible.Estuve en el concierto de Madrid(Vistalegre)y me emocione mucho cuando te vi.GUAPO.Me gustaria preguntarle si le esta costando asimilar la fama y si puede salir de marcha como antes con sus amigos.me gustaria que me mandaras un saludo.Muchisimas gracias y un besazo muy muy gordo para mi cantante preferido.BUSTA CAMPEÓN ERES EL MEJOR!!!

Object

1906Object23/06/2002 08:36:59

Hola, soy Jesús de Zaragoza. Aunque mucha gente no lo crea tú ya lo sabes, pero ¿que te parece que gente como yo, madurito y chico, sea fan tuyo hasta la médula?. Un abrazo y sigue siendo como eres, a nosotros nos tendrás detrás siempre. Y a los que no te comprenden y no nos comprenden, que te escuchen y que escuhen tu disco.

Object

1907Object23/06/2002 08:38:18

Puesto que a mi tambien me gustaria ser cantante y la gente dice que canto bien me gustaria preguntarte si te ha pasado como a mi: ¿Has tenido bajones pensando que no ibas a llegar a lo que has llegado?

Object

1908Object23/06/2002 08:38:20

Bustamante mojate, tienes alguna relacion especial con Gisela dí la verdad. Por favor

Object

1909Object23/06/2002 08:38:27

Puedes ir a Suecia alguna ves.... te queremos un MONTON aqui!!!!

Object

1910Object23/06/2002 08:39:14

¿Que sentiste cuando te dieron los 5 discos de platino de golpe? Muchos Besos que sigas triunfnado. Me encanta tu disco.Ana de Madrid

Object

1911Object23/06/2002 08:39:47

¿Como se puede ser tan buen artista, tan buena persona y tan requeteguapo, sin morir en el intento?...... y por cierto como haces ahora para no llorar.......? Te deseo lo mejor "Artiston", te lo mereces. Un Besazo BUSTY.

Object

1912Object23/06/2002 08:41:20

MAS QUE HACER UNA PREGUNTA QUERIA DECIRTE QUE VAS A LLEGAR LEJOS, ALGUIEN ME DIJO UNA VEZ QUE LA GRANDEZA DE UN HOMBRE NO SE MIDE DE LA CABEZA AL SUELO SINO DE LA CABEZA AL CIELO, Y NO ALCANZA EL INFINITO ENTERO PARA MEDIR LA TUYA. QUIERO DEDICARTE LA CANCION SUEÑOS DE DIEGO TORRES. KARINA .VENEZUELA

Object

1913Object23/06/2002 08:41:29

¿Alguna vez te dijeron que cantabas mal???

Object

1914Object23/06/2002 08:42:07

soy, de sonseca un pueblo de Toledo, y me gustaria preguntarte si podras venir alguna vez aquí? hazlo por nosotras q te queremor mucho. ¿te gustaría cruzar el charco para promocionar el disco? ojalá q si, pq eres el mejor y te lo mereces. felicidades. un besazo.

Object

1915Object23/06/2002 08:42:25

BUSTAMANTE , COMO HACES PARA ESTAR TAN GUAPO SIEMPRE . CADA VEZ QUE SALE ALGO RELACIONADO CONTIGO NO DUDO EN COMPRARMELO , PUEDE SER PRENSA O ALGUNA PUBLICACION . ME HAN DICHO QUE ESCRIBA MI DIRECCION AQUI Y TU ME ESCRIBIRAS , DE HECHO MIS AMIGAS LO HAN HECHO , PERO EN UNA ENTRVISTA NO ME PARECE APROPIADO. a VER CUANDO VUELVES A MURCIA QUE TE DE UN PAR DE BESOS . AUNQUE A MI HERMANO NO LE HAGA MUCHA GRACIA . ¿SABES POR QUÉ NO CAUSAS LA MISMA SENSACION EN EL PUBLICO MASCULINO ? RESPONDEME ME HARÍAS MUY FELIZ.

Object

1916Object23/06/2002 08:43:59

Has evolucionado muchiiiiissiiiiimmmoooo, te veo mucho mas asentado en el escenario y estas que te sales, por cierto me encanta tu disco, sobretodo las marchosas ¿ Qué opinas de Carlos Baute las dos canciones que te ha regalado son canela fina me ponen.......? Un Beso grande, CAMPEON. Sigue así Bustirrinin mío.

Object

1917Object23/06/2002 08:44:31

Hola David. Felicidades por tu disco y por esa voz tan maravillosa que tienes. ¿Cuáles crees que son las claves de tu éxito? Un beso. Encarni

Object

1918Object23/06/2002 08:45:11

¿Como se puede ser tan buen artista, tan buena persona y tan requeteguapo, sin morir en el intento?...... y por cierto... ¿como haces ahora para no llorar.......? Te deseo lo mejor "Artiston", te lo mereces. Un Besazo BUSTY.

Object

1919Object23/06/2002 08:47:22

David,ya has conseguido tu sueño, pero ahora que se ha hecho realidad, tendrás otro, ¿cuál es?

Object

1920Object23/06/2002 08:48:45

hola guapeton!!!!primero enhorabuena por ese peazo de disco,¿no te planteaste en ningun momento hacer un disco con ninguno de tus compañeros?un besazo.Laura(Madrid)

Object

1921Object23/06/2002 08:49:48

hola david soy una chica de zaragoza me llamo virginia. me gustaria saver si vas a venir a firmar discos a zaragoza.eres el mejor un beso desde zaragoza guapeton. besos.espero que me puedas responder

Object

1922Object23/06/2002 08:50:01

se que ahora tienes muchos fans y que te arropan mucho, incluyendome a mi. ¿Pero no crees que este boom se pasara con la segunda etapa de Operación Triunfo y vosotros os quedareis anticuados?.Muchas gracias por ser como eres y demostrar a todos que en el Norte tambien tenemos "arte por las venas".TQUIERE UNA BILBAINA.

Object

1923Object23/06/2002 08:50:14

Hola soy Dolores ya que es verano cuando te vas aponer en bañador y enseñar ese cuerpo sexy que tienes

Object

1924Object23/06/2002 08:51:04

ola wapisimo!soi emma de melilla,keria decirte si tienes novia ;)decirte tb k daria mi vida por conocerte,bueno eso y l k kieras.sé k si te digo k te kiero no te lo vas a creer,pero es lo k siento en lo mas profundo de mi.bueno david,mi sueño:conocerte.eres el mejor para mi y con eso me basta.haria lo k fuera para k seas feliz si no lo eres.un beso muy grande te kiero mucho :*

Object

1925Object23/06/2002 08:52:01

SOY UNA FAN TUYA DESDE EL PRIMER DIA,A Q SE DEBE EL PRECIO TAN ELEVADO DE LAS ENTRADAS DE LA PLAZA DE TOROS DE VALENCIA?SERAN MAS BARATAS LAS DE PATERNA?ESE PRECIO IMPIDE Q PODAMOS ACUDIR A VER NUESTRO SUEÑO,VERTE ACTUAR A TI EN DIRECTO.

Object

1926Object23/06/2002 08:53:06

¿Seria posible que algun dia te tengamos por este lado del mundo en un concierto para Republica Dominicana? Mariant Bueno, Santo Domingo

Object

1927Object23/06/2002 08:53:42

hola Busta soy Marta dun pueblo d Sevilla ( el viso del alcor). Tu junto con david Bisbal sois mis preferidos. Os kiero muchísimo a los dos. fui a vuestro concierto en sevilla y kiero ir al tuyo en solitario y al d Bisbal por supuesto k tb. mi pregunta es k si vas a venir a sevilla y cuando. Ojalá q vengas. Tkiero muchísmo wapisimo.

Object

1928Object23/06/2002 08:55:42

HOLA BUSTA, FELICITACIONES POR TUS TRIUNFOS. QUISIERA SABER CUANDO PODRAS VENIR PARA VENEZUELA, YAQUE AQUI TIENES MUCHISIMOS FANS. TE ESPERAMOS LO MAS PRONTO POSIBLE. MARIA DESDE VENEZUELA

Object

1929Object23/06/2002 08:55:55

busta el dia de tu concierto en las palmas de g. canaria vas a volver a firmar discos es que hice cola para terminar llorando por que no me firmastes el mio

Object

1930Object23/06/2002 08:56:52

donde va a ser tu concierto de las palmas

Object

1931Object23/06/2002 08:56:58

¿Que te animo a hacer los desnudos? Sarah Garcia Republica Dominicana

Object

1932Object23/06/2002 08:57:01

David yo se que aunque has ascendido demasiado rapido y la prensa no te a tratado igual de bien que a los otros dos ganadores los primeros días,con tu disco les has demostrado que se equibocaban. Ya que es el mejor.Zorionak!Sinceramente cual de tus compañeros crees que llegara más alto? Mojate y ojala seas tú.UNA BILBAINA QUE TE QUIERE.

Object

1933Object23/06/2002 08:58:29

te gusta la maravillosa isla de g.canaria tienes muchas fans te queremos mucho

Object

1934Object23/06/2002 08:59:08

Isa de Valencia - Venezuela: ¿Piensas en venir a Venezuela? Aqui te queremos mucho.

Object

1935Object23/06/2002 08:59:40

en que hotel vas a estar cuando vengas a g.canaria

Object

1936Object23/06/2002 09:00:45

¿Como seria la mujer perfecta para ti? Michelle Bueno Republica Dominicana

Object

1937Object23/06/2002 09:01:13

¿No te sientes un poco aislado ahora que no puedes salir ni a tomarte un café tranquilamente con quién tú desees? Un besín de Fanny.Asturias

Object

1938Object23/06/2002 09:01:59

estas muy orgulloso de ser cantabro yo estoy muy orgullosa de ser canariona y de ser fans de un cantabro

Object

1939Object23/06/2002 09:02:43

Te escribo ante todo para felicitarte y decirte que te vere en algun concierto,seguro!. Busta, cuando te dijeron que eras el tercer ganador flipaste. Ahora que has vendido más discos que la ganadora, que se te pasa por la cabeza? Bilbao.Natalia.

Object

1940Object23/06/2002 09:03:52

Q TAL TE LO PASASTE EN LAS PALMAS EL SABADO 22 DE JUNIO? AFRICA (LAS PALMAS)

Object

1941Object23/06/2002 09:04:29

Hola David, soy María una chica de Córdoba que piensa que eres el mejor del mundo. Me gustaría preguntarte si vas a venir algún día por Córdoba a firmar discos. Muchos besos y espero que todo te vaya tan bien como hasta ahora. Tu fan nº1: MARÍA GUERRERO :)

Object

1942Object23/06/2002 09:04:48

me gustaria conocerte en persona para ver si eres tan simpatico como en la tele asi que vuelve pronto por g.canaria y traete a geno y a alex

Object

1943Object23/06/2002 09:06:32

busta te has enamorado alguna vez de verdad yo si de ti te quiero mucho

Object

1944Object23/06/2002 09:08:17

que dia actuaras en Oviedo?es verdad que vienes a Oviedo el 16 de julio?? tu fan nº1 de oviedo sarini

Object

1945Object23/06/2002 09:09:03

Hola. Soy Isabel Ramos de Venezuela. Mis padres son muy amigos de Lorenzo Barriendos "El Diablo". ¿Que es lo que mas extrañas de la Academia?

Object

1946Object23/06/2002 09:09:49

es verdad que cuando eras pequeño viviste en mi tierra oviedo????''''' sarini

Object

1947Object23/06/2002 09:10:58

David... ¿por qué tu gira no pasa por extremadura? Porque no haces un hueco en tu apretada agenda y vienes por aqui con Vero, por qué ella es tu compañera de gira ¿verdad? por aqui se te quiere mucho lo pudiste comprobar cuando viniste a dar tu concierto a Mérida. Por mi parte decirte que me has hecho llorar más de una vez, con tu emoción,arte y desenvoltura en el escenario llegarás altísimo. DE LA FAN QUE ESPERA CONOCERTE ALGÚN DÍA. SOLE. BESOS. ¡SUERTE CAMPEÓN! ¡ERES EL MEJOR!

Object

1948Object23/06/2002 09:12:03

holaaaaaaa!!!!! Me llamo MªCarmen preguntarte si piensas en un futuro escribir tus canciones para el disco?? como te ves de aqui a unos años?????? Solo decirte que cuando estuvisteis en valencia estuvisteis geniales y tu muy guapo con ese pañuelo fallero en lo 2 conciertos.Espero q te pases x aqui pa' firmar discos si vienes hazlo con tiemnpo q luego muxa gente nos quedamos con las ganas. Un beso muy fuerte te espero el día 10 de julio en ese concierto con la Vero que ganas!!!!.Una valenciana!!!!!!! P.D= Xfavor cnt q siempre q hay algun chat nuncan me cnt Ah! dale a Álex un beso tu q lo veras

Object

1949Object23/06/2002 09:13:01

hola!dicen que estas enamorado de gisela.enhorabuena!aunque tendrias que conocerme igual cambias de opinion.estais juntos?

Object

1950Object23/06/2002 09:13:15

saludo a uno de los que mas vale en este mundo!! te queria preguntar que si tras este exitazo de tu primer disco, vas a sacar espero que muy pronto un nuevo trabajo en el que te animes a componer algun tema, que seguro que sera un exito, por cierto ¿vas a venir a valencia a firmar discos? prque tenemos ganas de verte!! 1 besazo muy fuerte. Ana.

Object

1951Object23/06/2002 09:14:29

¿Qué tal te sientes con la acogida que ha tenido tu disco? yo lo tengo y me encanta. Bea, Cádiz.

Object

1952Object23/06/2002 09:15:52

HOLA DAVID SOMOS DE URUGUAY Y SOMOS FANS DE TODO EL GRUPO DE OPERACION TRIUNFO, POR EL CANAL INTERNACIONAL NO NOS PERDIMOS NADA NI SIQUIERA EUROVISION, Y DESPUES LA REPETICION POR CANAL ABIERTO,MAS QUE UNA PREGUNTA ES UN DESEO,¿HABRIA UNA POSIBILIDAD DE QUE REALIZEN UNA GIRA POR AMERICA LATINA Y SI LOS DISCOS PUDIESEN LLEGAR PRONTO, YA QUE EN LAS RADIOS SUENAN MUY BIEN? CARIÑOS FLORENCIA.GRACIAS POR LA PORTUNIDAD DE MANIFESTARME.SUERTE IDOLO !

Object

1953Object23/06/2002 09:15:57

el 16 de julio en oviedo.nos vas a cantar asturias patria querida???nos haria mucha ilusion sarini

Object

1954Object23/06/2002 09:17:24

vas a venir a firmar discos a Oviedo a a algun lado de asturias??'porfavor contestame ya que llevo llendo 5 veces a "los prados" porque me decian que venias a firmar discos sarini

Object

1955Object23/06/2002 09:17:29

hola como estas me llamo macarena , quiero saber de quien estas enamorado en la academia, y si ella te corresponde, chao sigue asi de guapo un besote

Object

1956Object23/06/2002 09:18:25

¿PIENSAS VENIR A MURCIA A FIRMAR DISCOS? PORFAVOR AKI TE ESTAMOS ESPERANDO

Object

1957Object23/06/2002 09:18:48

bustamante eres el mejor ¿siempre as estado en contra de la pirateria?¿como crees q se podria concienciar a la gente de q esto puede acabar con la musica?nuria bcn

Object

1958Object23/06/2002 09:19:35

por favor en oviedo el dia 16 de julio cantanos el himno de tu pueblo ya que me queda un cacho por aprendrer.podras???????' sarini

Object

1959Object23/06/2002 09:19:43

TE QUIERES LIGAR CONMIGO?ERA DE COÑA GUAPOOOOOOOOOO

Object

1960Object23/06/2002 09:22:06

¿NO TE DA PENA HABER TENIDO KE DEJAR TODA TU FAMILIA Y TUS AMIGOS A CAMBIO DE LA FAMA?

Object

1961Object23/06/2002 09:22:20

hola soy sandra: en Madrid y provincia, qué días, vas a actuar y donde. Un besazo

Object

1962Object23/06/2002 09:25:57

ME PODRIAS DEDICAR UNA CANCION EN EL CONCIERTO DE OVIEDO????ME LLAMAN SARINI

Object

1963Object23/06/2002 09:26:21

¿crees q el exito t puede alejar d tus amigos de toda la vida?animo campeon eres el mejor

Object

1964Object23/06/2002 09:26:39

SOY DE ECUADOR Y NO ME PERDI NI UN SEGUNDO DE OPERACION TRIUNFO, AUNQUE ACA LA PASAN ATRASADO PERO POR EL INTERNET ME INFORME DE TODO, LO QUE QUIERO DECIRTE ES QUE ERES TREMENDAMENTE HERMOSO, PRECIOSO, MI PREGUNTA ES ¿CUANDO VIENES PARA ECUADOR? QUE TE QUIERO VER SIP, UN BESO INMENSO PORFIS CUIDATE MUCHO ATTE. GABY. sheisgabita@hotmail.com

Object

1965Object23/06/2002 09:27:13

cuantas copias vendidas de tu primer disco?? yo creo que tienen qe ser mas de 1 millon, no???

Object

1966Object23/06/2002 09:31:03

Soy de Chile, no soy española, veo operación triunfo (por la señal intercional)desde la academia, pero no puedo estar este lunes en el chat, sólo quiero decir que en Chile recibirián con gusto a los chicos de operación triunfo, aquí se hace un festival internacional de la canción. Soy fans de Bustamante, me gusta su estilo, si me podría mandar un mensaje me haría feliz. Un beso enorme a DAVID BUSTAMANTE de su fans chilena Paulina Díaz (paulinadiazc@hotmail.com)

Object

1967Object23/06/2002 09:32:07

Q HACES AHORA Q NO TIENES GIRAS?GUAPO CONTEXTA SOY SANDRA MARTINEZ DE CALAHORRA LA RIOJA Y TENGO TU DISCO Y M LO PONGO TODOS TODOS LOS DIAS.ERES UN TIO Q ME GUSTA COMO CANTA Y COMO ES ERES GUAPO Y LO TIENES TODO ALGUN DIA LLAMAME Y DEDICAME UNA CANCION Y CHARLAS CONMIGO ES 616710320 XFA LLAMA SI NO LLAMAS PUES DA IGUAL OTRO DIA M LLAMAS.

Object

1968Object23/06/2002 09:32:20

Hola David , me gustaria saber si vas a dar algun concierto por Teruel o algun pueblo de Teruel como Andorra , Alcañiz ,Calanda . MUCHA SUERTE GUAPETON ERES EL MEJORRRRRRRRRRR TE KIERO .(SANDRA)

Object

1969Object23/06/2002 09:32:42

Hola David! soy Miguelina de Republica Dominicana... mi pregunta para ti es, cuál ha sido el momento más amargo de tu vida y cuál el mejor hasta ahora?... de paso te invito a que visites Rep. Dom. donde mucha gente te conoce y te quiere, un beso y sigue asi de guapo!

Object

1970Object23/06/2002 09:33:59

¿Te acuerdas de todos y cada uno de tus antiguos colegas de tu pueblo?Ahora tendras muchas nuevas amistades

Object

1971Object23/06/2002 09:34:57

¿Crees que todo está marchando como debería en esto de las listas, discos de platino y demás? ¿No tienes la impresión de que a la fuerza quieren hacer de vuestras carreras en solitario una disputa, una especie de "a ver quien puede más"? Odio las comparaciones y a la fuerza a todos nos están obligando a estar haciéndolas siempre y no es justo, ni para tí ni para ninguno, supongo. Quizás no te encuentres muy cómodo con mis preguntas y te pido disculpas de antemano, dándote también las felicidades y desearte que sigas como hasta ahora que bien alto que vas a llegar, pese a quien pese...... Un besazo.

Object

1972Object23/06/2002 09:36:17

David! te gustan las dominicanas? o todavia no conoces ninguna? avisame porque puedo ser la primera o no? UN BESO GUAPO! miguelinamadera2000@yahoo.com

Object

1973Object23/06/2002 09:37:20

hola david, me llamo Florencia y soy fans tuya. mi prefunta es ¿vendras a cantar aqui en Uruguay? gracias y un beso

Object

1974Object23/06/2002 09:38:25

decirte q eres genial ¿que as aprendido en la academia?¿cuando cantas aplicas las mismas tecnicas que te enseñaron los profesores?

Object

1975Object23/06/2002 09:39:23

hola david me llamo Florencia y soy re fans tuya. mi pregunta es¿vas a venir algun dia a cantar aqui en Uruguay? GRACIAS Y TE QUIERO MUCHO

Object

1976Object23/06/2002 09:39:35

buenas,soi una de las personas que admira tu trabajo y esfuerzo ,mediante en la acadamia y fuera de ella,tengo 12 años y me preguntaba,ya que me gusta cantar y componer¿como puedo ser como tu o al menos que me den una oportunidad?te mando un abrazo y gracias por darme esta aficcion a cantar y componer.!gracias!

Object

1977Object23/06/2002 09:40:30

hola david soy una gran fans tuya no puedo chatear con tigo el lunes porq no tengo internet en casa mitlf es 627640802 llamame porfa besazooooooooooooossssssssssss.guapo

Object

1978Object23/06/2002 09:41:13

hola david soy una chica de la rioja ke te ha seguido desde tu entrada en la academiay kiero decirte ke eres el mejor no xq cantes bien sino xq tienes una manera de ser increiblemente alucinante de verdad ke TE KIERO NURIA

Object

1979Object23/06/2002 09:42:14

yo no quiero preguntarte nada pero si decirte que eres el mejor que nunca cambies y decirte que si me podias enviar algo dedicado para mi por favor mi direccion es camino artana nº60 puerta 4ª burriana (castellon) codigo postal 12.530 te lo agradeceria muchisimo. te quiero lorena 12 años

Object

1980Object23/06/2002 09:42:21

cantas fenomenal,fuera un poco del tema¿que te parece la eliminacion de españa?justa o no justa,¿cual jugador te gusta mas?

Object

1981Object23/06/2002 09:44:50

HOLA DAVID. SOY COLOMBIANA Y DESDE COLOMBIA E SEGUIDO TU CARRERA DESDE EL PRINCIPIO Y MIL FELICITACIONES. CUENTAME, SERA QUE ALGUN DIA VENDRAS A COLOMBIA A TRAER TU SHOW? SERIA INCREIBLE...

Object

1982Object23/06/2002 09:45:18

soi un chaval pequeño pero admirado por tu trabajo me gustaria hacerlo ¿como?yo me lo estoi trabajando ayudame enviandome un consejo,gracias.

Object

1983Object23/06/2002 09:47:06

te felicito por tu trabajo y aunque sea muy pronto para decirlo !ánimo!y a por el segundo disco

Object

1984Object23/06/2002 09:48:00

¿estas contento con la reaccoin d la gente respecto a tu disco?¿crees que en un futuro segiras brillando con tanta luz como ahora?espero que si nuria

Object

1985Object23/06/2002 09:48:25

Esto de hacerte preguntas es un poco complicado pq supongo que habrá mucha gente haciéndolo, así que voy a ser un poco diferente David. Soy Inma, de Bollullos del Condado (Huelva) tengo 20 años y soy músico, toco el oboe. Quiero darte la enhorabuena y decirte que sigas pa´lante como el que más pq siempre estaremos akí y tú sienpre estarás allí...en nuestros corazones. Gracias por hacernos disfrutar tanto y por supuesto, nos veremos en tus conciertos. Un beso mu grande y hasta siempre guapetón.

Object

1986Object23/06/2002 09:48:36

¿los chicos de operacion triunfo junto con vos van a venir algún día a Argentina?

Object

1987Object23/06/2002 09:49:02

hola busta,te gustaria q te dieran el disco de diamante??esperas conseguirlo????

Object

1988Object23/06/2002 09:49:48

Hola David!Todos estamos encantados con tu CD, ¿como crees que sera tu lanzamiento en el mercado latino? (Sudamerica).Un besazo desde tu foro de portalmix. Nuria

Object

1989Object23/06/2002 09:50:06

¿crees que los proximos concursantes de operacion triunfo os pueden desbancar?un beso, nuria

Object

1990Object23/06/2002 09:51:11

no te gustaria salir con una colombiana buenisima..anota mi telefono 678007703 ...llamame

Object

1991Object23/06/2002 09:51:14

en tu paso por gran canaria , para la participación del world dance music , el domingo que fue el ultimo dia de tu estancia , supuestamente tenias que salir por la puerta central del hotel y salistes por otra.¿de quien fue esa idea?sabemos que no es tu culpa , pero han roto el sueño de muchas de nosotras.aqui se te quiere mucho.por cierto , no se si te acordaras pero en la firma de discos te regale una gorra adidas.¿te gustó?¿te la has quedado?muchos besos.te quiere mucho tu fan nº 1. eres el mejor. silvia , las palmas de gran canaria.

Object

1992Object23/06/2002 09:51:59

sabes q conozco tu clonn es un ex mio...bueno tu estas mas bueno pero hay q conformrse

Object

1993Object23/06/2002 09:58:40

HOLA GUAPÍSIMO.ME HAN DICHO QUE ESTE VERANO VAS A PATERNA(VALENCIA)CUANDO SON FIESTAS.¿ES CIERTO?¿PARA QUE DIA SERÍA?ME ALEGRO QUE TODO TE VAYA FENOMENAL.ÓJALA PUDIESE CONOCERTE EN PERSONA PORQUE TE QUIERO UN MONTÓN.NO CAMBIES.ERES EL MEJOR.A SEGUIR TRIUNFANDO!!!SONIA(vCIA)

Object

1994Object23/06/2002 09:59:20

Hola guanpo!!soy de Puerto Rico y quisiera saber si vas a venir en tu gira para Puerto Rico? porque la verdad estoy loca por verte ,yo te amo busta!!! att Vivianne G. Torres Duran

Object

1995Object23/06/2002 10:00:27

¿El concierto que vas a dar en Ponferrada en Septiembre va a ser con Vero?

Object

1996Object23/06/2002 10:03:57

¿Qué tal te lo pasaste el sábado en el concierto de Las Palmas de Gran Canaria?¿Se portaron bien cuando saliste a cantar?

Object

1997Object23/06/2002 10:07:53

Hola David: soy Florencia desde Buenos Aires, ARGENTINA. Aquí ya sos conocido, muy querido y apoyado a lo largo de tu camino por la Academia. Mi pregunta es si tenés pleneado en tu gira de promoción visitar latinoamérica y por favor Argentina. No veo la hora de poder conseguir tu disco aquí, ya que me encantaría tenerlo. Sos un excelente artista, tenés una voz increiblemente bella y mucha suerte en tu carrera. Ojalá puedas venir por acá pronto. Te dejo mi dirección de e - mail, me encantaría que me escribas: florencia_silvina_soriano@ciudad.com.ar Un beso grande Florencia

Object

1998Object23/06/2002 10:08:13

David estas con gisela??? eres el mejor de operacion triunfo y cantas de maravilla.muuuuuuuuuuuuak

Object

1999Object23/06/2002 10:10:19

Bustamante haber cuando pasas por mallorca.besos!;)

Object

2000Object23/06/2002 10:11:59

¿VAS A VENIR A GRANADA EN TU GIRA EN SOLITARIO?ANIMO GUAPETON!!! ROCIO DE GRANADA

Object

2001Object23/06/2002 10:13:23

¿TE MOLESTA QUE TE DIGAN QUE ERES EL QUE SIEMPRE LLORAS?NO LES HAGAS CASO UN BESAZO ROCIO DE GRANADA

Object

2002Object23/06/2002 10:16:44

¿te gustaria tener a gisela por nivia?

Object

2003Object23/06/2002 10:16:55

Hola cielo!!¿crees que o.t solo es un fenomeno que pasara de moda,o que tus fans te seran fieles?no canvies nunca David,que vales mucho.("y solo se me ocurre amarte...jejeje)Un beso!!Lorena(l´Olleria/Valencia)

Object

2004Object23/06/2002 10:20:32

hola david soy nacho de sevilla ¿¿que supone para ti estar un dia cantando en la tuna de tu pueblo a pasar a ser un artistazo como eres ahora??espero que vengas a sevilla nacho sevilla

Object

2005Object23/06/2002 10:20:35

¿vas a ir en concierto a Pamplona?

Object

2006Object23/06/2002 10:21:08

Busta, k te parece k vayas de gira con vero? Cuantos conciertos teneis previstos este verano juntos? besos Ana, Ibiza

Object

2007Object23/06/2002 10:22:47

ola david soi una fan d operacion triunfo tu y tosa sois los k mas m gustaia por vuestra naturalidad y sinceridad y claro por vuestras voces eres fan d ella y los demas? t sabes alguna d sus canciones? como ves k estarias en unos años? por favor no perdais el contacto con mucho cariño y un besazo d part d davinia d las palmas

Object

2008Object23/06/2002 10:22:51

Busta eres el mejor! El homenaje k te hicieron en Cantabria fue precioso. Como te sentiste al estar con toda tu gente? Besos Ana, ibiza

Object

2009Object23/06/2002 10:23:21

Cuando saldra tu disco?

Object

2010Object23/06/2002 10:25:07

BUSTAMANTE VENDRAS A REINOSA A LAS FIESTAS DE SAN MATEO AQUI TE ESTAMOS ESPERANDO CON LOS BRAZOS ABIERTOS BSOS DE UNA FANS TUYA GUAPO

Object

2011Object23/06/2002 10:25:34

Mi hija Mélodie viene de Belgica en agosto y sera muy contenta de verte, pero me prejunta ¿quien viene contigo en el spectaculo de Vera el 18 de agosto? Gracias, gilbertlenertz@yahoo.fr yo vivo aqui en Vera. de todo mi corazon, suerte en la vida.

Object

2012Object23/06/2002 10:25:51

Sabes ya cual sera tu 2ª single? El primero ha sido muy a tu estilo. Pero ahora en el veranito te quedaria muy bien la de "EL AIRE QUE ME DAS" BESOS TU FAN ANA DESDE IBIZA

Object

2013Object23/06/2002 10:26:06

crees que O.T. ha hecho que interese más la música a otros sectores de la población, niños y gente mayor, con lo que se beneficiaran otros cantantes?

Object

2014Object23/06/2002 10:26:54

¿ vas ha venir a cantar a laredo? irantzu bilbao

Object

2015Object23/06/2002 10:27:41

Te gustan las coreografias que te ha hecho tu paisano Poty? ANA,IBIZA FELICIDADES POR TU DISCO!!!

Object

2016Object23/06/2002 10:28:35

¿ Vas a venir a Córdoba Capital para dar algún Concierto o Firmar Discos ?

Object

2017Object23/06/2002 10:29:32

Sinceramente, Crees que vas a seguir en el mudo de la música mucho tiempo?

Object

2018Object23/06/2002 10:30:45

¿ Cómo debe ser la CHICA de tus SUEÑOS ?

Object

2019Object23/06/2002 10:31:41

Busta, Primero le quiero felicitar con su CD y le deseo lo mejor para el futuro. Como ya sabes el OT no solamente fue un exito en Espana, pero tambien en todo Europa! Aqui desde Holanda estuvimos mirando OT cada semana. Bueno mi pregunta sera el siguiente... Sera posible dar un concierto aqui en Holanda? Tu solo o con todo el equipo de OT. Para que sepas que aqui tambien tienes tus fans. Saludos, Becsy..

Object

2020Object23/06/2002 10:32:18

Hola guapeton.¿Que es lo que mas as aprendido en la academia? un beso de Lorena Alcorcon.

Object

2021Object23/06/2002 10:32:38

¿POR QUE SE TE HA SUBIDO TANTO LA FAMA A LA CABEZA CON LO NATURAL QUE ERAS EN LA ACADEMIA Y LO FAMILIAR QUE TE COMPORTABAS CON TU PUBLICO?

Object

2022Object23/06/2002 10:33:39

quieres una dominicana

Object

2023Object23/06/2002 10:34:26

Qué opinión te merece la poca promoción que te está haciendo tanto tu compañía discográfica?.

Object

2024Object23/06/2002 10:34:32

Imagino que tanto tú como tus compañeros estaréis agradecidos por toda la publicidad que habéis conseguido estos meses. ¿No es algo injusto que otros grupos o solistas nuevos de gran calidad pasen desapercibidos por 'vuestra culpa'?

Object

2025Object23/06/2002 10:34:55

NOS HABIAN DICHO QUE QUERIAS ESTUDIAR DERECHO PERO¿POR QUE TE FUISTE DERECHO A LA ACADEMIA DE OPERACION TRIUNFO?

Object

2026Object23/06/2002 10:37:21

HOLA BUSTA ¿CREES QUE TE VA BIEN CON TU DISCO? UN BESAZO.LAURA DE SEVILLA

Object

2027Object23/06/2002 10:37:59

hola David, primero quiero felicitarte por tu éxito y me gusta mucho tu cd, pero tenga una pequeña queja, aunque mas que queja es pregunta, te cuento el sabado estuve en el concierto World Dance Music, en Las Palmas y estuve en la zona Vip, detras del escenario (me saludaste)y lo que no entiendo es porque no permitian que pudieras saludar a las personas que estabamos hay detras del escenario con ganas de verte y con ganas de que nos regalases tu bonita sonrisa y dijeras "hola" por lo menos, la verdad senti una gran desilución respecto a eso, imagino que no tendras tu la culpa de ese comportamiento. Un beso muy fuerte y te deseo de corazon mucha suerte. Adios guapo

Object

2028Object23/06/2002 10:37:59

cuando vas a venir a valencia a firmar autografos?

Object

2029Object23/06/2002 10:38:36

Soy una fan cuarentona, así que no pueden decir de tí que solamente te siguen las quinceañeras. Espero que se terminen las discriminaciones hacia este chico, porque creo que es injusto y se merece tener su oportunidad tanto como los demás y en mi opinión es mejor que algunos otros que están superpromocionados.

Object

2030Object23/06/2002 10:39:21

Que reacción harias si uno de tus compañeros te confesara que es gay? que le dirias? que le recomendarias? lo mirarias de otra forma? lo aceptarias?

Object

2031Object23/06/2002 10:41:05

Que sentiste el dia que hiciste el concierto en Santander hace poco. Marta.

Object

2032Object23/06/2002 10:42:05

Bustamante es verdad que te gusta Gisela

Object

2033Object23/06/2002 10:42:42

¿Dónde será el segundo concierto que darás junto a Vero en La Rioja?

Object

2034Object23/06/2002 10:43:30

David,¿es verdad que quieres a gisela como algo mas que una amiga?por favor aclaramelo.De parte de una fans muy triste que te ruega que no te enamores si no va a perder la cabeza.Eres el mejor, sigue asi.te quiero.miriam de murcia

Object

2035Object23/06/2002 10:46:20

Hola David, ¿q piensas acerca de los artistas q critican al programa O.T? ¿Crees q lo hacen por q no ven justo q lo hayais tenido más "facil" q ellos?, yo creo q si, y tambien creo q sois los mejores. Un besazo

Object

2036Object23/06/2002 10:48:03

Hola David, ¿es posible q os volvais a reunir los 16 para cantar la canción q ha compuesto Juan? Guapisimo, eres el mejor.

Object

2037Object23/06/2002 10:53:10

¿¿lees las cartas q te escriben tus fans???

Object

2038Object23/06/2002 10:55:48

hola busta, soy una chica de Pucela a la que le encanta tu música y tu persona. No pude ir a León ni a Salamanca a verte y me gustaría saber si vendrás a Valladolid pronto o a otra provincia de Castilla y León. Un beso fortísimo y no cambies nunca. Dalsy.

Object

2039Object23/06/2002 11:01:01

ola busta!soy una chica de potes q t keria preguntar si t sientes cantabro d verdad. muxos besos dsd potes y q sepas q stamos contigo. TE KIERE: Seila

Object

2040Object23/06/2002 11:06:15

BUSTA. MIA AMOR, TE KIERO MUXO, MAS Q A MIS PADRES.......Q SEPAS Q YO SIEMPRE TE APOYARE,EN SERIO, NO SABES LO MUXO Q TE KIERO,WENO, SOLO ERA ESO,MUXOS BESOS DE TU FAN Nº 1:SONIA, 15 AÑOS

Object

2041Object23/06/2002 11:06:52

Busta cuando podras visitar venezuela que opinas de las fanaticas latinas

Object

2042Object23/06/2002 11:07:34

Hola David simplemente para felicitarte y decirte que cantas fenomenal y tienes un carisma incereible y para preguntarte has mencionado en varias entrevistas que uno de tus artistas favoritos en Luis Miguel, quisiera saber si ya lo conociste o si has tenido algun acercamiento con él.

Object

2043Object23/06/2002 11:08:12

Cuando vendras a venezuela. Que opinas del publico latino.

Object

2044Object23/06/2002 11:10:31

Cuando tu te subes a un escenario, te fijas en la cara de la gente, on en que???

Object

2045Object23/06/2002 11:10:35

david cuando vengas a mallorca que se que vienes solo actuaras en ese pueblo o vendras a mas sitios?

Object

2046Object23/06/2002 11:13:26

wer

Object

2047Object23/06/2002 11:15:04

hola busta soy tu fan numero uno te quiero mucho eres el mejor cantante de todo el mundo y mejor hombre,pero podras sacar un nuevo disco mejor q este te juro q me voy a comprar todos los discos q saques te quiero wapoooo eva (coria) (caceres)

Object

2048Object23/06/2002 11:15:29

bueno realemnete esta no es una pregunta, lo ùnico que quisiera decirte es que te admiramos mucho y que te queremos un monton. Atte, Vanessa Solòrzano (ECUADOR)

Object

2049Object23/06/2002 11:15:58

Es verdad que harás promoción en México? Deseamos con ansia poder verte en nuestra ciudad...Eres un verdadero talento. Te queremos Busta..Fabiola México, D.F.

Object

2050Object23/06/2002 11:16:14

¿Tu eres un poco chulin en tu pueblo antes de ser famoso?

Object

2051Object23/06/2002 11:17:40

Has estado enamorado???? Lo stas????

Object

2052Object23/06/2002 11:18:00

Hola David wapisimo!!!te quiero preguntar que:Como te sientes al haber trabajado con una figura tan importante como lo es Juan C. Calderon? porque te lo mereces, eso y mucho mas!!! Exitos y besos, para ti y gis!!!

Object

2053Object23/06/2002 11:19:59

cuando vas a venir a valencia a firmar discos?¿ un besazo.Y k estas buenisimo.sandra berezo (valencia)

Object

2054Object23/06/2002 11:20:10

Wapoooooo!Mi pregunta es para saber cual es tu relacion con Gisela???? , espero que sea mas que amigos!!! Un Besazo wapo!!!

Object

2055Object23/06/2002 11:21:11

David eres todo un campeon,y eso lo has demostrado , Te hubieses imaginado estar aqui hoy?? Natalia, bcn

Object

2056Object23/06/2002 11:21:50

mira soy Belinda y queria preguntarte el porque cuando estabas en la obra dices que nunca piropeabas o silbabas a las muchachas? Eres muy guapeton y ademas de ti no hay mas. Besos

Object

2057Object23/06/2002 11:23:00

David eres el mejor, y de eso no hay duda, Como te sientes en este punto crucial de tu vida?? Maria, Santander

Object

2058Object23/06/2002 11:23:52

¿Cómo es tu chica ideal?

Object

2059Object23/06/2002 11:24:27

Campeonnnnn!!! Si tuvieras que elegir entre la musica y el amor de tu vida, cual seria tu eleccion?? Maria, Malaga

Object

2060Object23/06/2002 11:24:51

¿Es verdad que estas saliendo con Gisela?

Object

2061Object23/06/2002 11:25:32

¿Se ha enamorado de alguien en la Academia? ¿ De Gisela , tal vez?

Object

2062Object23/06/2002 11:26:01

David ademas de ti no hay mas, creeme, Mi pregunta es que cual seria la chica perfecta para ti, describela, por favor!! Un beso, y todo lo mejo pa ti wapo!!! Natalia,madrid

Object

2063Object23/06/2002 11:27:48

el otro dia en tu omenaje bailando en una cancion diste unas vueltas como las de bisbal porque lo imitas

Object

2064Object23/06/2002 11:29:32

David eres un libro abierto, y todo un artista, por eso no hay preguntas solo halagos para ti wapo, y por favor, que me respondas con un mensajillo!!!! te quiero artista, un beso y una pecha de exitos! Laura, Terrasa

Object

2065Object23/06/2002 11:31:43

Me gustaría saber porqué en el disco no aparece la canción que, tanto él como Sergio Dalma habían prometido cantar juntos, porque lo que no creo es que haya sido por la combinación de horarios, querría saber la razón verdadera

Object

2066Object23/06/2002 11:32:43

q sientes al subirte al escenario y al ver todas esas caritas llenas de emocion, te fijas en todas???

Object

2067Object23/06/2002 11:32:45

Porqué en el disco no aparece la canción que iban a cantar Bustamante y Sergio Dalma, no me creo que haya sido por los horarios, quisiera saber la razón verdadera.

Object

2068Object23/06/2002 11:33:00

Artistaa, pedazo de artista wapo!!! Como te ves de aqui a 10 años?espero que te quedes por aqui deleitandonos con tu maravillosa voz y personalidad, por 50 años mas!!! exitos wapo!!! Ana, Valladolid

Object

2069Object23/06/2002 11:35:43

que piensas hacer, cuando seas viejo y otros artistas te reemplacen?? volveras al andamio???

Object

2070Object23/06/2002 11:35:58

¡Aupa Busty!Tu disco es genial.¿Hay alguna canción en el que sea especial para ti o con la que te identifiques más?Espero que nunca cambies y sigas siendo tan humano como hasta ahora.Un abrazo tio.Javi(Bilbao).

Object

2071Object23/06/2002 11:39:45

que si echas en falta tu anterior vida porque esta claro que esto lo que quieres pero a veces no es un poco agobiante,Y un deseo no cambies que no te deslumbren los alagos y que te quiero un monton en el buen sentido porque casi podia ser tu madre ah que piensa ella de lo lejos que estas y que no te puede ver todos los dias.Y te vere en Valencia besos Maria Jesùs

Object

2072Object23/06/2002 11:42:12

Hola, me llamo Andrea y te escribo desde México, D.F. Soy tu fan desde que salió el programa de Operación Triunfo, y en uno de los últimos oí que planean hacer una gira de promoción a mi país. ¿Me podrías decir cuando? Me encantaría ir a verte... Muchos besos y mucha suerte!

Object

2073Object23/06/2002 11:43:32

Busta,firmaras discos cuando vengas al concierto en Las Palmas el 27 de julio?? (es ke a mi,como a muxas,no nos pudiste firmar el 22 cuando viniste,pero sabemos k TU KERIAS y k NO FUE TU CULPA) Besitooos desde Gran Canaria.Ruti.

Object

2074Object23/06/2002 11:45:26

¿Qué es lo primero que se te pasa por la cabeza cuando te despiertas cada mañana?.Un besuco desde tu tierruca David.

Object

2075Object23/06/2002 11:49:22

David, no me gustaría sembrar polémica, pero con el pedazo de canción que tienes, Sábes porqué no apareces en la lista de los 40?. Un besazo, eres el mejor y el único que dia a dia me sorprende gratamente.

Object

2076Object23/06/2002 11:50:01

Ha sido un día agotador, entrevistas, rueda de prensa, firma de discos, todo el tiempo rodeado de personas que ansían una sonrisa tuya, un autógrafo;después de todo eso cuando llegas al hotel,¿Hechas algo en falta?.

Object

2077Object23/06/2002 11:50:20

BUSTA: ¿NO VIENES A CANTAR A VALLADOLID?, ALOMEJOR NO PUEDO ESTAR A LA UNA EN EL CHAT PERO ME GUSTARIA VER TU RESPUESTA MAS TARDE CUANDO PUEDA ENTRAR, BESOS: CRISTINA P.D: ME GUSTAS MUCHO POR ESO HE REGALADO A MI MADRE EN VEZ DE UN RAMO DE FLORES O UNA ROSA, CAJA DE BOMBONES O ESO TANTO ME GUSTAS QUE LE HE REGALADO TU CD, QUE SIGAS ASÍ, ERES MARAVILLOSO ¡¡¡¡¡¡¡¡GUAPO, SIGUE ASÍ, NO CAMBIES NUNCA!!!!!!!!!! UNA FAN DE BUSTA, CRISTINA DE 10

Object

2078Object23/06/2002 11:51:10

si ya puedes vocalizar bien porque parece que aveces te trabas

Object

2079Object23/06/2002 11:52:00

Hola David, soy Nadeska desde Venezuela, sé que ahora la promoción del disco está fuerte en España, pero ¿no sabes cuando empieza por latinoamérica? estoy ansiosa de escucharte aquí en mi país,soy tu fan desde los inicios de OT,muchos besos...Nadeska

Object

2080Object23/06/2002 11:53:01

Hace un año, cuando estabas en Oviedo haciendo cola para el casting de Operación Triunfo, se te pasó por la cabeza en algún momento que tu vida iba a dar un giro de 180 grados?

Object

2081Object23/06/2002 11:55:02

Busta eres lo mejor de la academia y vas a llegar muy alto, mi nombre es Begoña Machuca Sanchez y soy Presidenta de ADEBAM(asociación para la ayuda y defensa de los abusos sexuales a menores en España)con sede en la ciudad de Cáceres, somos la única asociación en España y se acaba de crear por ello estamos organizando un concierto benefico he hablado varias veces con tu representante pero el dice que no quiere que tu hagas cosas beneficas, sera para septiembre o Octubre seguramente Gisela si venga, quisiera saber si tu estás dispuesto a ayudarnos y venir a cantar, nosotros pagariamos tu hotel y otros gastos, por favor me es imposible contactar contigo de otra forma te pido que me respondas si estas interesado a ayudar a que estos niños no sufran tanto, si quieres saber más escribeme a adebam@telefonica.net y te dare nuestro telefono, quizás nos hayas visto en television ya que estos ultimos dias hemos estado bastante fue alli donde coincidi con Gisela y esta dispuesta a apoyarnos, si tu tambien lo estas por favor respondeme y te lo agradeceremos, o dime donde puedo escribirte o llamarte ya que tu representante se niega a que tu hagas algo benefico pero yo confio en tu buen corazon, te mando un beso muy fuerte y te deseo todo lo mejor, puedas o no por favor responde, mil gracias. Begoña Machuca Sáchez(Presidenta ADEBAM)

Object

2082Object23/06/2002 11:55:35

Hola Busta! Soy un chaval que cuando te veia en operacion triunfo no me decias nada ( no me gustabas mucho ), te quiero decir que he descubierto tu disco, y, te he descubierto a tí. Ahora eres el mejor para mi. Que opinas de la gente que te ha descubierto ahora??? Crees que todavia te puede querer mas gente de la que te quiere???. Elamigodegisela-15

Object

2083Object23/06/2002 11:55:41

Piensas que Vale Music no te esta promocionando lo suficiente?

Object

2084Object23/06/2002 11:56:12

Algo que nos inquieta,y que sabemos con certeza que no va a ser, pero que nos gustaria saber por tí. es que si la fama hara cambiar tu sencillez, tu saber estar con el publico, ser tu mismo y tu sencibilidad con el mismo.

Object

2085Object23/06/2002 11:57:12

Array

Object

2086Object23/06/2002 11:57:13

¿Cuál es el secreto para llegar hasta dónde has llegado?.Déjame decirte que yo pienso que has llegado al corazón de muchos de nosotros porque sientes lo que cantas y lo haces con una voz que no muchos tienen la fortuna de poseer.Porque eres tú mismo, una persona estupenda y transparente que pone pasión en todo lo que hace.No nos cambies David.

Object

2087Object23/06/2002 11:58:13

bustamante,cuando vas a venir a alicante a firmar disco?y de concierto vas a venir?1besazo ana de alicante

Object

2088Object23/06/2002 11:58:41

De todas las cosas que has aprendido desde que entraste en la academia: ¿Cuál es la que jamás se te va a olvidar?

Object

2089Object23/06/2002 11:59:43

¿A partir de qué momento empezaste a sentir seguridad en el escenario?

Object

2090Object23/06/2002 11:59:52

Quisiera saber porqué en el dico no canta Bustamante con Sergio Dalma cuando ellos dos lo habían prometido.No me creo que fuese sólamente por los horarios, quisiera saber la razón verdadera.Gracias y felicidades por tu éxito.

Object

2091Object24/06/2002 12:00:52

¿Cuándo vas a venir por akí por tu tierruca para firmarnos los discos?

Object

2092Object24/06/2002 12:02:21

HOLA DAVID SOY DE EL EDO.LARA VENEZUELA Y MI SUEÑO ES CONOCER A TODOS LOS Q PARTICIPARON EN OPERACION TRIUNFO.MI PREGUNTA ES SI A TI TE GUSTARIA VENIR A VENEZUELA A DAR UN CONCIERTO CON TODOS TUS COMPAÑEROS.

Object

2093Object24/06/2002 12:02:41

Hola busty!!¿puedes describir en tres palabras como fue el paso por la academia?Muxos besos.Laura.Jerez

Object

2094Object24/06/2002 12:04:02

Hola David, soy de Caracas, venezuela y aquí los adoramos a todos, quisiera saber cuando vas a venir a Venezuela tu solito o con tus compañeros, de verdad deberían hacerlo, porque aquí no se imaginan como los vamos a recibir, sigue así guapo, te queremos, Marie de Pool

Object

2095Object24/06/2002 12:08:57

Hola busty!!¿podrias definir en tres palabras el paso por la academia?Muxos besos.Laura.Jerez

Object

2096Object24/06/2002 12:09:14

Antes de todo hola!!! Teng tantas cosas que preguntarte que nose cual elegir,para mi eres el mejor desde el primer dia que te vi y simpre lo seras porque eres único,siempre me pregunto k como llevas ese gran cambio k ha ocurrido en tu vida,se que es lo que simpre habías soñado pero ahora no pasa mucho tiempo con las personas que mas te quieren y eso no es bueno pero por eso quiero que sepas que todas tus fans te apoyamos y te apoyaremos siempre que haga falta nunca lo olvides.Me despido ya con un fuerte beso y recordandote que eres el mejor.MUA.

Object

2097Object24/06/2002 12:10:36

cuando va venir bustamante a valencia?porque stamos impacientes de que venga a firmar discos.

Object

2098Object24/06/2002 12:10:41

cuando vienes a firmar discos a madrid?????????xfavor dimelo q voy a ir a verteeeeeeee.xfa dilo.un besazo guapo.

Object

2099Object24/06/2002 12:11:55

HOLA DAVID , ME LLAMO ISRAEL O PEJINN EN EL CHAT ,SOLO TE QUERIA DECIR QUE TE ADMIRO MUCHISIMO TE LO DIGO AHORA POR QUE SERA MUY DIFICIL O CASI IMPOSIBLE DECIRTELO EN PERSONA,TU MADRE ME CONOCE DISELO. ¡¡¡¡¡GRACIAS POR LA ALEGRIA QUE NOS ESTAS REGALANDO, ARTISTA¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

Object

2100Object24/06/2002 12:14:10

HOLA DAVID ME LLAMO ISRAEL O PEJINN EN TU FORO. ¿ QUE SIENTES AL SABER QUE A GENTE COMO YO NOS ESTAS HACIENDO LAS PERSONAS MAS FELIZES DEL MUNDO? Eres un artista de los pies a la cabeza,recuerdos a tu madre, me conoce.

Object

2101Object24/06/2002 12:15:14

eres el tio mas bueno del mundo,y estas muy bueno que mas te gusta la musica o las chicas? jeje ¿echas de menos el trabajo de albañil y a tus amigos del curro?mis hermanos tambien son albañiles.Si tuvieras la oportunidad de ser profesor de o.t dirias ke si?. yoana zgz

Object

2102Object24/06/2002 12:15:34

Hola Busta! Que tal? Soy tu fan número 1 y se oyen rumores de que vas a dar un concierto en Medina del Campo (Valladolid) Es eso verdad? Espero tu respuesta. Sigue así y triunfarás por muchos años!!!!

Object

2103Object24/06/2002 12:15:53

¿vendras de gira por sevilla?tus fans de aqui te queremos mucho.besos

Object

2104Object24/06/2002 12:16:45

¿cuanto darias por tus fans?eli,sevilla

Object

2105Object24/06/2002 12:21:27

David, ¿Cuál piensas que es el secreto para tener el club de fans que tienes?

Object

2106Object24/06/2002 12:23:50

que es en lo primero q t fijas de una chica? mandanos un beso a los torrentinos,que te quieresn mucho.y a mi tambien.elena.

Object

2107Object24/06/2002 12:26:10

Hola David, mi nombre es Vanessa y vivo en Santo Domingo. Soy una super fan tuya y me gustaría verte en persona algún día. Por un canal local de mi país están repitiendo Operación Triunfo y no me lo pierdo. Está entre tus planes venir por aquí?

Object

2108Object24/06/2002 12:28:39

hola Busta!!antes de nada darte darte las gracias por ese peazo de disco q has hecho.PREGUNTA:Tu que ya eres un gran cantante y que puedes tener ya más o menos tus propias ideas,creer que Christian tiene razón con lo de los tonos?.Un besazo.Mireia(Torrelavega)

Object

2109Object24/06/2002 12:29:27

hola guapeton.tu disco es precioso cuanto mas lo oigo me gusta mas ,todas las canciones una maravilla¿piensas cantar alguna vez en ingles?cantes como cantes lo haces genial,quiero que sea agosto para verte otra vez en elche.no cambies nunca.te quiero mucho.angie.

Object

2110Object24/06/2002 12:30:05

Soy Vicky: Lo primero de todo es decirte que no cambies nunca y que tu disco es precioso. Y la pregunta es: ¿si tú sabes cuando salen las entradas de el concierto de Murcia?, es que me da miedo quedarme sin entrada. Gracias, eres el mejor. MUCHOS BESOS,GUAPO

Object

2111Object24/06/2002 12:30:35

Hola david..quisiera saber si entra en tus planes visitar el Pais vasco para firmar discos ya que por desgracia no hemos tenido la suerte de tenerte en concierto.mil besos yodi bust AMANTE

Object

2112Object24/06/2002 12:32:23

tu club de fans es muy importante para ti y lo has demostrado mas de una vez haciendo alarde del famoso pañuelo y nombrandolo en mas de una ocasion , ¿que le dirias a toda esa gente que dice que busta no es mas que eso que un club de fans? Nina

Object

2113Object24/06/2002 12:33:20

¿HAS TENIDO QUE RENUNCIAR A MUCHAS COSAS POR LA FAMA? ¿A CUALES TE HA COSTADO MAS TRABAJO RENUNCIAR?

Object

2114Object24/06/2002 12:35:21

Hola David,soy una chika de tu club de fans y del for,me gusataría saber que es exactamente lo que menos te gusta de nosotr2s tus fans ya se que siempre dices que somos los mejores y que nos quieres mucho y eso lo sabemos pero si hay algo que no te gusta dinoslo para así poder rectificar,tal vez te sientas en ocasiones agobiado por nosotros o te parezcamos demasiado protegedores...no sé algo q no te parezca bien?trankilo se sincero q lo entenderemos. Un besucu corazón. Andrea(pilladora)

Object

2115Object24/06/2002 12:36:22

Hola David! ¿Que tal la respuesta y el comportamiento de las fans allá por donde vas?

Object

2116Object24/06/2002 12:36:44

Hola David me gustaria saber si disfrutas bailando las coreografias tanto como nos haces disfrutar a nosotras viendote bailarlas¡¡que arte por dios¡¡¡oleeeeeeee eres un campeón¡¡¡ Un bustabeso pa tí. Andrea8pilladora)

Object

2117Object24/06/2002 12:36:55

Hola David!¿ es cierto que la cancion " contigo aprendi" tiene un significado especial para ti? si es asi,¿ podrias explicarnos cual? muchas gracias y un beso enorme de todo tu foro.Te queremos

Object

2118Object24/06/2002 12:37:04

bustamante,¿en el concierto de consuegra (toledo), viene la vero? 1 beso de rebeca, tufan nº 1 ¡tio bueno!

Object

2119Object24/06/2002 12:37:26

bustamante,¿en el concierto de consuegra (toledo), viene la vero? 1 beso de rebeca, tu fan nº 1 ¡tio bueno!

Object

2120Object24/06/2002 12:37:46

Hola Titín: Nos podrías decir algo sobre tu firma de discos?es que no tenemos mucha información y nos gustaría saber algo más. Un saludo,Andrea.(pilladora)

Object

2121Object24/06/2002 12:38:08

Busta, antes de salir de la academia querías completar tu formación musical, ¿Todavía tienes esta intención? Y si es así ¿De dónde sacarás el tiempo? ¿Dónde tienes pensado ir a estudiar? ¿Trabajarás con algún profesor de la academia?

Object

2122Object24/06/2002 12:38:24

Hola Busta soy Maria y me gustaría saber si es verdad que en Madrid centro no vas ha hacer ningun concierto, como algunos de tus compañeros. Ah! por cierto te queremos por como eres, por lo que nos has dado y no nos tienes que agradecer nada, en todo caso seríamos nosotros ¿vale? UN BESAZO ENORME de tu fan número UNO

Object

2123Object24/06/2002 12:39:44

Hola Busta¡¡ Podrías decirme exactamente que lazos te unen a Asturias ya que se dice que eres medio asturiano y nunca sabemos exactamente que lazos son esos ya que nadie lo sabe con certeza. En Asturias se te quiere mucho guapo¡¡ Ya veras lo bien que te lo pasas en el concierto de Asturias te acogeremos lo mejor posible,te lo mereces¡¡ Un besazo,Andrea(pilladora)

Object

2124Object24/06/2002 12:40:06

¿alex y tu os seguis llevando tan bien como antes o con eso d la mujer q la kereis los dos os habeis peleao?no cambieis nunca x fa.os kiero.alexfan

Object

2125Object24/06/2002 12:41:13

PIENSAS QUE A PARTIR DE AHORA Y YA QUE ESTAIS SOLOS CADA UNO POR SU LADO, ¿SERA MAS DIFICIL MATENERTE TAN ARRIBA COMO OS HAN DEJADO EL PROGRAMA OPERACION TRIUNFO? ESPERO QUE ESTE VERANO VENGAS POR SEVILLA. BESOS MANOLI Y ROCIO(MI HIJA DE 4 AÑOS Y SUPERFAN TUYA)

Object

2126Object24/06/2002 12:41:35

Que tal guapísimo? Espero que como siempre y que por Madrid te esperamos pronto porque se te hecha de menos. me gustaría poder conocerte y que tu me conocieses porque yo ya se que tu eres una persona muy grande (no soy la única que lo pienso) ¿vale? te queremos y esperamos que sigas siempre así. UN BESAZO ENORME. MARIA. CIAO

Object

2127Object24/06/2002 12:41:47

Cuándo lanzarás tu disco en Venezuela... Tienes planeada una gira por Latino América y si es así fecha tentativa... Besos, gracias por regalarnos tu talento y tu humildad. Me encanta como has prograsado

Object

2128Object24/06/2002 12:42:28

hola david,vas a venir a alicante a firmar?que sepas que te queremos mucho eres el mejor,te quiere tu fans nº1,1besazo ana de alicante

Object

2129Object24/06/2002 12:45:36

Hola david,cuando saldra como single la canción "EL AIRE QUE ME DAS" es una de mis favoritas y creo k va a ser bombazo este verano.Me encanta tu disco eres el mejor y siempre te apoyare.tq

Object

2130Object24/06/2002 12:45:38

David me gustaría saber ¿cuando vienes a Madrid a firmar discos? Es que llame a donde llame nadie sabe nada. UN BESAZO ENORME. MARIA.

Object

2131Object24/06/2002 12:46:45

David: eres un cielo y espero que más de una vez volvamos a coincidir.Te preguntaría muchas cosas,pero creo que importante sería que para aquellas personas que han tachado de cantantes de karaoke a los concursantes de OT les contaras cómo fueron tus comienzos en el mundo de la canción,si fuiste a alguna academia para modular la voz,etc.Muchos besos y gracias por darnos tanto cariño con tus canciones.Ery.

Object

2132Object24/06/2002 12:47:14

hola guapo, soy Nerea de zaragoza y me gustaria preguntarte como te sientes al saber que tu disco ha sido un autentico exito y tambien quiero decirte que tu disco esel mejor que he oido en mucho tienpo, vamos que es impresionante. Eres el mas grande, no cambies nunca y muchos besos. Mandanos besicos a zaragoza que nadie se acuerda nunca de nosotros. adios guapo

Object

2133Object24/06/2002 12:49:46

¿Vas a realizar una gira de presentacion de tu disco por todo el mundo, que paises vas a visitar?

Object

2134Object24/06/2002 12:49:56

Hola David,soy Andrea(pilladora) cual es tu mejor y peor recuerdo de OT?Ánimo que eres el mejor y el Diamante está asegurado¡¡¡Un besazo y gracias por existir¡¡Pasate por el foro de vez en cuando te esperamos cielo.

Object

2135Object24/06/2002 12:51:08

Hola David ¿que tal tu vida tan agetreada? A mi me gustaría saber si es posible que pudieses venir a mi pueblo (San Sebastián de los Reyes, Madrid) en fiestas (del 24 ó 26 de agosto al 31 ó 2 de septiembre) a cantar porque a mi y a mi mejor amiga nos encantaría y me gustaría darla una sorpresa. Muchas gracias. Te queremos. no hace falta que des más las gracias no debes nada. un kiss muy grande. MARIA.

Object

2136Object24/06/2002 12:54:55

¿como puede una persona llegar tan profundamente al corazon de las otras personas?¿que hay de especial en ti chiquitin?

Object

2137Object24/06/2002 12:58:56

No nos creemos que no has subido el numero de ventas de discos de 500.000 desde los primeros tres días, si llevas 4 semanas arriba, en las listas. ¿Puedes confirmar que ya tienes ventas de disco de diamante?

Object

2138Object24/06/2002 12:59:57

Me gusta mucho la canción Duda de Amor. Sin embargo lo mencionas poco. ¿Cuando lo vas a cantar?

Object

2139Object24/06/2002 01:00:14

Hola Nuria, esta es la pregunta ¿Que crees que has aprendido en este tiempo? y ¿Que te hemos aportado a nivel personal tus fans? Muchas gracias ,tus sueños son nuetros sueños,no cambies,eres el mejor,un besito.Amandita-nuria

Object

2140Object24/06/2002 01:01:46

hola guapo,los madriles necesitamos saver cuando vienes a firmar aqui,dinoslo xfi, q te queremos ver y para q veas q madrid te quiere un montonnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn.un besazo.dinoslo va???????ERES EL MEJOR

Object

2141Object24/06/2002 01:02:12

¿ David, estas enamorado o te quieres enamorar? porque puede que la mujer de tus sueños este mas cerca de ti de lo que tu piensas. Thais - madrid - una de las de la persecucion en coche.

Object

2142Object24/06/2002 01:02:24

Me encantó el programa de Crónicas Marcianas. Tienes un don especial para improvisar y te metes a la gente en el bolsillo. ¿Había partes del programa preparadas?

Object

2143Object24/06/2002 01:03:26

¿Qué se siente delante de 50.000 personas que corean tu nombre?

Object

2144Object24/06/2002 01:05:37

Tienes un físico envidiable. ¿Sigues preparándote físicamente como en la Académia?

Object

2145Object24/06/2002 01:06:47

Las Almas Gemelas se entienden con mirarse, nosostros te hemos visto feliz, responsable y agradecido. No te estarás olvidando un poco de VIVIR TU?. No lo hagas David, VIVE que la fuerza la encontrarás en las cosas cotidianas. Te queremos desde Toledo. Mayka=Mazapa

Object

2146Object24/06/2002 01:08:19

Tus atractivos al cantar, aparte de una voz maravillosa, son tu sonrisa y los sentimientos que transmites. ¿Cómo logras cantar con esa naturalidad? ¿No te pones nunca tenso o nervioso?

Object

2147Object24/06/2002 01:10:28

¿Eres consciente del "fenómeno Bustamante", y los sentimientos y admiración que despiertas en miles y miles de fans, que son de todas las edades?

Object

2148Object24/06/2002 01:10:33

Después de la gira ¿ya hay planes para un segundo disco?

Object

2149Object24/06/2002 01:10:38

Hola Busta! Como estas? Bueno solo te quiero preguntar,vas a venir a México algun día? Espero que si, tienes muchas fans aquí. Eres el mejor. Andrea-México

Object

2150Object24/06/2002 01:11:03

¿Sabes que eres un ejemplo para muchísimos jóvenes? Es una responsabilidad.

Object

2151Object24/06/2002 01:13:03

Nadie como tu ha sabido llegar tanto al corazón de la gente. ¿Puedes sentir el cariño que te tenemos cuando sales a cantar?

Object

2152Object24/06/2002 01:13:10

¿Crees que tu disco va dirigido a todas las edades?

Object

2153Object24/06/2002 01:13:22

¿Qué significa cantar para tí?

Object

2154Object24/06/2002 01:14:49

Algunos dicen que eres demasiado joven y que no sabrás asumir la fama. ¿Como logras mantener los pies en la tierra con todo lo que te ocurre?

Object

2155Object24/06/2002 01:15:56

¿Por qué te hicieron las fotos artísticas del cuadernillo?

Object

2156Object24/06/2002 01:16:14

¿Por qué no vienes a Tenerife?

Object

2157Object24/06/2002 01:16:42

vendras a las fiestas de pozuelo de alarcon(madrid),lo digo xq el año pasao vino david civera, haber si lo superas. lulu 15, bss tio bueno.cntesta

Object

2158Object24/06/2002 01:16:59

Como sabras tu fama no sólo es en Europa, sino inclusive en américa, cual es tu opinión respecto a esto?

Object

2159Object24/06/2002 01:19:06

¿Tienes programados conciertos multitudinarios o también en pequeñas salas?

Object

2160Object24/06/2002 01:19:38

hola david me llamo diana soy de ecuador y te avisa que aqui tienes tu propio club de fans, si pudes porfavor escribeme a mi mail para poderte informar bien yo no puedo conectarme a esta hora contigo por las diferencias horarias. mi mail es caro2907@hotmail.com

Object

2161Object24/06/2002 01:26:10

david queria decirte que sigas siendo como tu eres,aprte de tu maravillosa voz nos encanto tu forma de ser.dejate aconsejar por los que tienen mas experiencia pero conserva tu personalidad y ese algo que te hace tan especial:ese carisma que teneis algunos y que os hace "felizmente diferentes" a los demas.un fuerte abrazo de tu paisana:charo

Object

2162Object24/06/2002 01:28:29

hola, Bustamante. Mi nombre es Julissa, soy dominicana y mi pregunta es la siguiente: Cual es tu cancion favorita de tu cd's y por que? Espero que sigas logrando tus sueños. Adios, cuidate mucho.

Object

2163Object24/06/2002 01:38:20

¿No tienes planes de extender tu gira internacionalmente, por ejemplo, a Puerto Rico o a Estados Unidos?

Object

2164Object24/06/2002 01:39:25

¿ No tienes planes de extender tu gira internacionalmente, por ejemplo, a Puerto Rico ?

Object

2165Object24/06/2002 01:46:48

David , en primer lugar quiero que sepas que eres genial , pues te escribimos de ECUADOR el paìs màs bonito de Sur America, te escribe Mayra y Raquel. mi pregunta es para saber si puedes hablar con migo por el mail: raquelv-70@hotmail.com, bueno eso si tienes tiempo, porque debes de ser una persona muy ocupada. con esto nos despedimos y te mandamos muchos besos y suerte chaoooooooooooooo

Object

2166Object24/06/2002 01:49:48

Muchas felicitaciones para Bustamante, te deseo todo el exito del mundo, sigue adelante y de todo corazón deseo que tus sueños se te cumplan. Desde Guayaquil, Ecuador -Sudamérica

Object

2167Object24/06/2002 01:52:15

Querido David!!soy Mary de Cuenca-Ecuador... he seguido desde el comienzo tu participaciòn en OT. hasta el final por TV CABLE. es increìble el èxito que han tenido en tu paìs... Te imaginaste alguna vez tener tanto èxito a nivel MUNDIAL!!??? Hay alguna esperanza de recibirles en ECUADOR!???

Object

2168Object24/06/2002 02:05:57

Hola David!!! enhorabuena por tu disco!!! me podrias decir cuando vas a venir a firmar a Madrid??? un besazo de tus chicas madrileñas de la bandera de cantabria que tanto te quieren.

Object

2169Object24/06/2002 02:06:33

Array

Object

2170Object24/06/2002 02:09:17

Hola David! lo primero, es que tu disco es fantastico, increible! lo segundo, es que me gustaría saber si te arrepientes de haber entrado en la academia. un beso de una catalana

Object

2171Object24/06/2002 02:13:07

Ademas de ti no hay más... Te gustaría volver a ser el de antes, quiero decir, el no ser tan popular, el no ser cantante..? cuidate mucho y no cambies

Object

2172Object24/06/2002 02:18:48

soy la chica que le ha hecho la carta a bustamante, si se la dais no sé como voy a daros las gracias! si se la podeis dar y me podeis avisar de alguna manera os lo agradeceria, mi e-mail es lauraramirez10@hotmail.com. MUCHAS GRACIAS DE CORAZON

Object

2173Object24/06/2002 02:20:44

como te sientes al tener tanta gente que se pasan horas haciendo cola solo por verte un momento?

Object

2174Object24/06/2002 02:22:25

Como fue tu primer amor? me siento celosa de la chica que te tubo en sus brazos y te dejó escapar. Eres muy romántico? cariñoso? yo creo que sí! un beso muy fuerte de laura bcn

Object

2175Object24/06/2002 02:25:26

Hola feo! es una forma de hablar..! Cual será tu próximo single? espero que sea el de cuando hacemos el amor... esa canción es preciosa! Todas tus fans te apoyamos y te defendemos, no cambies y sigue siendo tu mismo! laura una catalana

Object

2176Object24/06/2002 02:28:41

Lo primero, que tu disco es lo más, te lo has currao de verdad! Lo segundo me gustaría saber si te gustaría que tus hijos se dedicaran a tu profesión? debe ser duro pero a la vez satisfactorio. un beso guapo

Object

2177Object24/06/2002 02:29:05

Me llamo Virginia y soy de Uruguay, Y creo que sos el mejor cantante que hay y que es impresionante como haces llegar las canciones al corazón y te quiero preguntar ¿ahora que ya cumpliste el sueño de canta tenés otro sueño? Besos, te quiero mucho ty te deseo lo mejor.

Object

2178Object24/06/2002 02:31:45

david estoy deseando que comiences la gira de este verano porque pienso ir a donde sea para verte! te quiero hacer una pregunta, no te da "miedo" el estar tanto tiempo lejos de tu gente, la soledad de los hoteles...? bsitos de una chica que te quiere

Object

2179Object24/06/2002 02:34:31

Hola, GUAPO!!!! Mi pregunta es: ¿qué es lo que más aprecias o amas en tu vida? de Jamie Irizarry(Saludos y muchos besos desde Puerto Rico!Te amo mucho,campeon!)

Object

2180Object24/06/2002 02:34:44

Que darías por tu ídolo? yo lo daría todo. Que darías por verlo? yo lo daría todo. Harías una locura por solo intentar tocarlo? yo la haría. Todo eso lo haría por tí, porque solo repiro el aire que tú me das. De laura que te quiere y te respeta por lo que haces

Object

2181Object24/06/2002 02:37:29

¿Alguna vez has hecho alguna locura de la que luego te hayas arrepentido? En clase te aburrias no? ya tenemos algo en común. Tu disco es precioso. JUDITH

Object

2182Object24/06/2002 02:40:36

DAVID BUSTAMANTE A POR EL DISCO DE DIAMANTE! eres único! Eres supersticioso? ah! y lo de las camisas es mortal, las que has llevado en la gala del martes esas que si que me gustan no las de los racimos! un beso ;)

Object

2183Object24/06/2002 02:44:12

Te gusta verte en las resvistas? tus fotos estan por todas partes, eso te molesta? un besazo

Object

2184Object24/06/2002 02:46:48

Hola cielo! Hechas de menos la obra? quiero decir, si hechas de menso el estar con tus compañeros del trabajo... ojala saques mas discos al mercado! TQ no cambies

Object

2185Object24/06/2002 02:46:54

Hola cielo! Hechas de menos la obra? quiero decir, si hechas de menos el estar con tus compañeros del trabajo... ojala saques mas discos al mercado! TQ no cambies

Object

2186Object24/06/2002 02:49:20

Han acertado con el estilo de música que tu quieras tener en tu disco? o está hecho en plan más comercial que no al estilo de bustamante? AUPA CANTABRIA! mucha suerte en tu vida, sigue así

Object

2187Object24/06/2002 02:51:38

hola busta!tu disco esta buenisimo!. una pregunta: te enamorarias de una latina?, un besazo y un abrazo bien grande desde república dominicana.( Teany.M.Grullon)

Object

2188Object24/06/2002 02:59:35

sabias que los fan de OT y de tu persona llegan hasta paises como Venezuela y otros lugares del mundo lejanos a España, añadiendo que en Venezela acaban de lanzar un progrma que pertenece a la misma idea de OT llamado fama y aplauso ?

Object

2189Object24/06/2002 03:05:53

Querido David, soy tu fan brasileño que conociste en Barcelona, querría te preguntar para cuando está prevista la promoción de tu disco en América y se incluirá a Brasil en el rotero? Te gustaría cantar en portugues? Acuerdas que el mercado brasileño es muy grande. Besos. Durval

Object

2190Object24/06/2002 03:06:06

Hola!recibe un cariñoso saludo desde el Peru de tu fan latinoamericana #1,eres el mejor y te mereces todo lo maravilloso q t esta pasando y mas.han pasado 8 meses desde aquel dia en q cambiaste el andamio x el escenario, ya no es un sueño todo esto, crees q tu sueño ya esta cumplido? hasta donde quieres llegar.tu crees q podre verte x aqui?q el pueblo peruano tenga el placer de conocerte?espero q si.q dios t bendiga.un beso,Mirella.

Object

2191Object24/06/2002 03:21:06

HOLA SOY DE MEXICO Y HE SEGUIDO PASO A PASO OPERACION TRIUNFO Y SOBRETODO A DAVID BUSTAMANTE. LO ME GUSTARIA SABER ES SI ALGUN DIA VA A VENIR A MEXICO Y CUANDO. GRACIAS JESSICA.

Object

2192Object24/06/2002 03:33:24

cuando vendras a venezuela?

Object

2193Object24/06/2002 03:50:52

¿Crees que jugar al despite como lo hacen Chenoa y Bisbal da resultados? Tu podrías haberlo hecho con Gisela y, sin embargo, nunca habéis hablado más de la cuenta de vuestra relación. ¿Se saca de esto que Bustamante es alguien auténtico y tranparente? Un abrazo, tienes una gran voz.

Object

2194Object24/06/2002 03:51:40

Preguntita desde la rep.Dominicaca.¿Con cual de tus artistas favotitos te gustaria grabar un dueto? ATT:Ivanova Rodriguez y Leidy Ruiz

Object

2195Object24/06/2002 03:54:39

Desde Rep.Dominicana.¿Como te proyectas en 10 años?. ATT:Ivanova Rodriguez y Leidy Ruiz.

Object

2196Object24/06/2002 03:59:00

Desde Rep.Dominicana.¿Aprobechando la gran popularidad que tienes tu le darias la oportunidad a una fan tuya que tenga cualidades con el canto y que su sueño sea poder ser una cantante de poder realizar un dueto contigo para que ella pueda tener una proyeccion en el medio de la musica grcias a tu apoyo? ATT:Ivanova Rodriguez y Leidy Ruiz.

Object

2197Object24/06/2002 04:00:25

Desde Rep.Dominicana.¿Aparte de la Musica tienes otra pasion en dadoo caso cual es? ATT:Ivanova Rodriguez y Leidy Ruiz.

Object

2198Object24/06/2002 04:01:50

No se si sabes pero tu disco ha tenido un éxito impresionante en Puerto Rico y eres considerado una de las voces mas talentosas de OT acá¿Como te sientes al saber de este éxito tna innesperado? Thais

Object

2199Object24/06/2002 04:01:57

te escribimos desde Argentina, seguimos el programa pero no podemos tener los cd, ¿cómo podemos hacer?

Object

2200Object24/06/2002 04:10:35

Hola, soy una fan de Peru? y quisiera sabes si vas a realizar alguna Gira por Sudamerica, exactamente por mi pais? Un beso, me encantan tus canciones.Silvina

Object

2201Object24/06/2002 04:25:09

hola david me llamo michelle cuando vienes a venezuela?

Object

2202Object24/06/2002 04:32:36

Busta! Hola! Soy de México, y ya nos enteramos de que vienes para acá.... nos podrías decir cuando podemos esperarte? Morimos de ganas por verte.... ADEMÁS DE TÍ, viene alguien más? Gracias, saludos y un beso de Andrea!

Object

2203Object24/06/2002 04:36:55

bueno como debes saber tenes fans en Republica Dominicana mi pregunta ¿Es si tienes pensado hacer un concierto aqui?

Object

2204Object24/06/2002 04:37:27

Hola Busta! Besos desde México! Sabemos que pronto vienes para acá, nos podrías decir más o menos porque fecha? Morimos de ganas por verte.... y ADEMÁS DE TÍ, viene alguien más de tus compañeros? Gracias busta, y saludos de Andrea

Object

2205Object24/06/2002 04:37:54

¿Como fue la experiencia de cantar a dúo con unos de nuestros máximas estrellas; Luis Fonsi? Thais Puerto Rico

Object

2206Object24/06/2002 04:38:11

hola david soy una super fan tuya de republica dominicana y quiero saber cuales han sido tus mejores amigos dentro de la academia . un beso eres muy lindo y tierno espero que nos visites pronto . ATT: ELAINE MARINEZ

Object

2207Object24/06/2002 04:48:35

Hola soy Valeria Cavalheiro de Salto una pequeña ciudad en el Norte de URUGUAY(América del Sur)quería preguntarte si en algún momento piensas hacer una gira mUNDIAL. Me despido BESOS,BESOS,BESOS PD:Soy tu fans numero uno en todo América

Object

2208Object24/06/2002 04:59:13

Hola David mi nombre es Maria del Carmen Redondo Ovando mira yo vivo en Bolivia mi abuelo es Español y mi papà estuvo por alla un año en Santander y ahora que volvio de alla me trajo unos Dc de operacion triunfo y no sabes me facino te deseo todo lo mejor del mundo y me pregunta es si tu tuvieras la oportunidad de dar algo tuyo a la gente que es pobre que es lo que dieras tu y por que?

Object

2209Object24/06/2002 05:05:22

Hola soy Sandra de México, ¿Cuándo vendrás a visitar a tus fans mexicanas?, te esperamos con mucha ilusión. Felicidades y mucho éxito

Object

2210Object24/06/2002 05:49:04

Hola Busta!!! un saludo desde Mexico me llamo Angelica y supe de OT por unas amigas argentinas que fliparon con vosotros he oido algunas de tus canciones y me han gustado mucho tenes una maravillosa voz!!!! mi pregunta es:vuestra gira en solitario sera solo en España?porque me encantaria que vinieras a Mexico ademas que aqui en el mes de Septiembre empezara nuestro OT.Espero que leas esto y un beso con cariño de una fan de Mexico.

Object

2211Object24/06/2002 06:05:32

Hola Bustamante, solo queria saludarte y decirte que me caes muy bien y me encanta tu forma de ser, me siento muy identificado contigo.. espero que estes por America muy pronto!!! E.G (Rep.Dom.)

Object

2212Object24/06/2002 06:05:46

soy de ecuadorlos he seguido paso a paso soy una fanatica hasta morir mi pregunta es ¿ podran hacer una gira internacional por america del sur ?, no tienen idea del exito que tendrian besos Ma de los Angeles

Object

2213Object24/06/2002 06:14:39

Soy de Ecuador en Sudamerica y me preguntaba si en algun momento te daras tiempo para venir a mi pais a dar un concierto!?

Object

2214Object24/06/2002 06:18:06

Hola david Te mando un saludo desde MEXICO ¿Cuando te veremos en MEXICO y piensas lansar tu disco aqui (en que fechas) y a donde te podemos escribir (mi mail fanmexicana_no1@hotmail.com) ?Ojala pronto vengas y podamos conocerte en perosna espero respuesta ATTE. Yolix

Object

2215Object24/06/2002 06:30:45

Hola soy Soli desde Puerto Rico te envio muchos besos, Mi pregunta es Piensas venir a visitarnos por aca en Puerto Rico algun día?

Object

2216Object24/06/2002 06:46:32

hola me llamo jessica soy de republica dominicana. Mi pregunta es censilla como te sientes tu como persona en el medio donde te estas desenvolbiendo y con toda sinceridad no te sientes avese un poco presionado algo mas te felizito tienes una voz presiosa y sigue luchando que lo que te porpongas lo puedas conseguir.

Object

2217Object24/06/2002 06:47:15

Hola !! DAVID soy MEXICANA y ya compre tu disco via internet ya me llego y todo muchas felicidades es el mejor hecho de ustedes, sin dejar a un lado que el de manu, chenoa y nuria tambien estan muy padres, pero fijate que me quede con ganas de comprar los discos de las galas pero como compre 4 cds de ustedes me quede con poca lana y quisiera saber si cuando vengan a MEXICO van a vender los cds de las galas o de ustedes?????por que si no me voy a tener que poner a ahorrar ya que en el envio de los cds me sale mas caro bueno muchas gracias y soy fan de todos!!!!!

Object

2218Object24/06/2002 06:47:49

Hola !! DAVID soy MEXICANA y ya compre tu disco via internet ya me llego y todo muchas felicidades es el mejor hecho de ustedes, sin dejar a un lado que el de manu, chenoa y nuria tambien estan muy padres, pero fijate que me quede con ganas de comprar los discos de las galas pero como compre 4 cds de ustedes me quede con poca lana y quisiera saber si cuando vengan a MEXICO van a vender los cds de las galas o de ustedes?????por que si no me voy a tener que poner a ahorrar ya que en el envio de los cds me sale mas caro bueno muchas gracias y soy fan de todos!!!!! mi nombre es sofia saldivar hernandez

Object

2219Object24/06/2002 06:59:23

Hola David te escribo desde Chile. Mi pregunta es ¿Dentro de tus planes esta el venir a latinoamerica proximamente?. Suerte en tu carrera y felicitaciones por tu éxito.

Object

2220Object24/06/2002 07:05:42

hola me llamo jessica soy de republica dominicana. Mi pregunta es censilla como te sientes tu como persona en el medio donde te estas desenvolbiendo y con toda sinceridad no te sientes avese un poco presionado algo mas te felizito tienes una voz presiosa y sigue luchando que lo que te porpongas lo puedas conseguir. timiz28@hotmail.com

Object

2221Object24/06/2002 07:09:22

hola david bustamante soy una gran fans tuya soy de republica dominicana quiero que vengas a hacer un concierto tuyo aqui me encantaria mucho. ¿podrias venir a cantar aqui? bye te admira mucho alicia de republica dominicana

Object

2222Object24/06/2002 07:23:04

hola me llamo jessica santiago soy de republica dominicana. (timiz28@hotmial.com) mi pregunta es muy sencilla como te sientes tu dentro del medio en que te estas desarrollando como artista. vi que al principio del programa no sentias mucha confiansa en ti mismo. pero creo que lo estas superando muy bien ya que llegaste ala final un consejo no le haga caso alo que digan los demas ten confiasa en ti y veras tu lo puedes lograr todo si te lo propones okey .

Object

2223Object24/06/2002 07:35:45

HOlA precioso! Se tienen rumores aqui en Puerto Rico de que tu y tus compañeros podrian estar en la isla para darnos un concierto... es cierto esto?? pero aunque no vinieran todos, vendrias como parte de tu gira como solista???Te esperamos! BESOTESSSS desde PR. Canela

Object

2224Object24/06/2002 08:01:35

No quiPREGUNTAR SOLO QUIERO DECIR QUE ME GUSTAN SUS MUSICAS Y DECIR QUE VEO EL PROGRAMA POR TV ESPAÑOLA INTERNACIONAL Y QUISIERA 1 CIDI AUTOGRAFIADO

Object

2225Object24/06/2002 08:04:19

YA SABEMOS QUE VIENES EL 27 DE JULIO A LAS PALMAS DE GRAN CANARIA ¿ PERO VENDRAS CON ALGUN COMPAÑERO DE OPERACION TRIUNFO? .CARLOS DE LAS PALMAS

Object

2226Object24/06/2002 08:18:55

¿Tienes programado algún concierto en Madrid-capital es que no me lo puedo perder? tu disco es una pasada y por favor no cambies nunca. Gracias Ana. Madrid

Object

2227Object24/06/2002 08:24:22

Qué planes tienes despues de finalizar los conciertos? ¿Harás uso de la beca que ganaste en OT para continuar tus estudios de canto? Un beso.

Object

2228Object24/06/2002 08:29:50

David: Tu disco es precioso. Sabiamos que tenias una voz privelegiada pero es que es mucho mas de lo que pensabamos. Tambien estoy muy contenta por todo el esfuerzo que ha hecho Miguel Gallardo. Definitivamente que, como tu dices, ha sido un padre para ti. Besos y no cambies nunca esa maravillosa manera de ser. Y cuando quieras llorar hazlo.

Object

2229Object24/06/2002 08:35:24

¡Hola David!lo primero decirte que eres fantástico, que te admiro muchisimo y que nos has regalado un pedazo de disco. ¡Jo! ¿por qué no haces la gira con Gisela? Os quiero mucho a los dos. Un besazo

Object

2230Object24/06/2002 08:35:55

David, soy músico desde hace 26 años (profesional desde hace 15) y muy poca gente me ha logrado conmover con su música o con su voz. ¿Qué sientes al saber que has vendido más de un millón de discos?. (Porque, desde luego, te lo mereces).

Object

2231Object24/06/2002 08:36:00

¿HUBO ALGO ENTRE TU Y GENO? ¿Y ENTRE TU Y GISELA?

Object

2232Object24/06/2002 08:45:51

HOLA ME GUSTARIA PREGUNTARTE SI VAS A IR A FIRMAR A VALENCIA Y SI ES ASI CUANDO. GRACIAS ¡¡¡¡AUPA BUSTA!!!!.LORENA 12 AÑOS CASTELLON

Object

2233Object24/06/2002 08:46:46

HOLA, ME ENTERADO QUE EL DOMINGO 28 DE JULIO SE EMPIEZA EN ARANJUEZ UN CONCURSO LLAMADO OPERACION SASAKUS EN EL CUAL SE LE HABIA OFRECIDO A DAVID BUSTAMANTE IR A ENTREGAR LOS PREMIOS, EL CUAL NO VA HA PODER IR YA QUE PIDE MUCHO DINERO, SIN EM BARGO VA A IR MANU TENORIO QUISIERA QUE ME CONFIRMARA SI ESTO ES CIERTO.

Object

2234Object24/06/2002 08:50:41

HOLA YO NO QUERÍA PREGUNTARTE NADA PERO SI DECIRTE QUE TENGO MAS DE 100 FOTOS TUYAS EN UN ALBUM Y TAMBIEN 20 POSTERS Y NO TENGO NINGUNO FIRMADO ME PODIAS ENVIAR ALGUNO POR FAVOR MI DIRECCION CAMINO ARTANA Nº60 PUERTA 4º BURRIANA (CASTELLON)CODIGO POSTAL 12530 Y ME LLAMO LORENA TORNADOR ANDREU DE 12 AÑOS UN BESITO.

Object

2235Object24/06/2002 08:54:16

HOLA YO NO QUERIA PREGUNTARTE NADA PERO SI DEDICARTE ESTAS POESIAS QUE ESPERO QUE TE GUSTEN:SIEMPRE TE HE QUERIDO SIEMPRE TE QUERRE BUSTA DE MI ALMA EN MI CORAZON TE TENDRE. HAHI VA LA OTRA.:TUS CANCIONES SON IMPRESIONANTES TUS FOTOS SON ALUCINANTES BUSTA ERES ACOJONANTE.LORENA 12 AÑOS CASTELLON.

Object

2236Object24/06/2002 08:57:07

HOLA BUSTA TE QUERIA FELICITAR POR TU DISCO ES UNA MARAVILLA NO ME ESPERABA MENOS DE TI ¡¡¡ARTISTAZO!!! Y TAMBIEN POR LAS FOTOS DE TU DISCO ES QUE ¡¡¡¡ESTAS COMO UN TREN !!!! TE QUIERO LORENA 15 AÑOS CASTELLON

Object

2237Object24/06/2002 09:00:14

HOLA ME GUSTARIA DECIRLE A BUSTA QUE ME ENCANTA SU VIDEOCLIP PERO HAY UNA COSA QUE NO ME GUSTA QUE HAY MUCHAS CHICAS CONTIGO QUE RABIA ME DAN ELLAS (ES BROMA LO COMPRENDO)HASTA LUEGO LORENA 12 AÑOS CASTELLON

Object

2238Object24/06/2002 09:01:40

BUSTA LEI EN UNA REVISTA QUE FUISTES ELEGIDO TRES AÑOS SEGUIDOS EL MAS GUAPO DEL INSTITUTO ¿ES ESO VERDAD? LORENA 12 AÑOS CASTELLON .

Object

2239Object24/06/2002 09:06:40

En el programa de Bustamante y amigos de TVE1, pudimos comprobar una vez más el artista que Bustamante lleva dentro, además de la sencillez y la dulzura que a mi parecer le caracterizan. ¿Cómo viviste ese día? ¿Que significo para ti?

Object

2240Object24/06/2002 09:11:08

Hola Busta, eres el mejor!

Object

2241Object24/06/2002 09:21:56

¿que harás si no consigues lanzar un segundo cd y mantenerte? espero que estoy no ocurra y por cierto no cambies (eso te dará más suerte) besos

Object

2242Object24/06/2002 09:22:42

¿que harás si no consigues lanzar un segundo cd y mantenerte? espero que esto no ocurra y por cierto no cambies (eso te dará más suerte) besos

Object

2243Object24/06/2002 09:24:27

ME GUSTARIA SABER SI EN EL CONCIERTO DE VALENCIA,CANTARÁS EL DUO CON ALEX.ES LA CANCION QUE MAS ME GUSTA.SUERTE.ERES EL MEJOR.1BESO.LAURA(VALENCIA).

Object

2244Object24/06/2002 09:26:29

Una vez demostrada tu valía como artista, ¿te preocupa el segundo disco? Enhorabuena por el primero: es lo que esperábamos.

Object

2245Object24/06/2002 09:29:37

Hola David: Enhorabuena por todos tus éxitos. Soy de Bilbao y por aquí tienes muchos seguidores y seguidoras. Os estuvimos viendo en el concierto de Vitoria y estuvistes magnífico. Por favor, haz todo lo posible para venir a Bilbao o a algún punto de Euzkadi, ya que al parecer en tu gira no está previsto. Esto ya es urgencia Nacional. Te deseo toda clase de éxitos. Un beso muy, pero que muy fuerte. ANA

Object

2246Object24/06/2002 09:29:42

David, me gustas mucho como cantas, pero un defecto y muy grande q tienes, es q imitas mucho a david bisbal, haces muchos gesto etc.. q son de el, y con esta opinion coincidimos mucha gente, así q se tu mismo y no imites a alguien q es inemitable. besos. 1 valenciana

Object

2247Object24/06/2002 09:31:35

Hola, has conseguido tu sueño, no lo dejes escapar, aprovechalo!¿Qué crees que será de David Bustamante dentro de varios años, crees que podría ser tu pareja una compañera de ot?Besos.

Object

2248Object24/06/2002 09:34:52

Quedaste con Sergio Dalma en la final de Operacion Triunfo en que cantarias juntos una canción en tu disco, ahora mismo sois mis dos cantantes favoritos ¿Por qué razón no lo habeis hecho al final?

Object

2249Object24/06/2002 09:40:35

todo el mundo o casi todo el mundo pensamos que habia algo entre gisela y tu nos podias confirmar esto, y si es asi porque ella no ha participado en tu disco, muchas gracias y mucha suerte te lo mereces

Object

2250Object24/06/2002 09:42:08

David Somos dos fans de Gipuzkoa. Nos dieron un número tuyo pero nunca nos contestas. Puedes llamarnos? Es que queremos hablar contigo, o dejanos un número por favor. Nuestro número 659772206. Muchas gracias guapo!!!

Object

2251Object24/06/2002 09:45:27

bueno busta antes de preguntarte quiero decirte que eres uno de los mejores artistas del mundo, que cantas muy bien ,que eres bello y que tienes muy buen cuerpo aparte de que me encanto tu cd y soy del fan club de republica dominicana ,ahora mi pregunta es cuando vienes de gira por aqui???

Object

2252Object24/06/2002 09:46:55

viéndote en la gala del lunes como bailabas me convences más que puedes llegar a ser un artista muy completo. Sigue así, me haces vibrar con tu voz y ahora con tu cuerpo.¿por qué no lo hicistes más en la academia? Susana, de Málaga

Object

2253Object24/06/2002 09:47:12

David,nos puedes contar como ha sido tu experiencia como actor de cine?Sabemos que la pelicula se estrena en Septiembre nos puedes adelantar algo?Besos Marián

Object

2254Object24/06/2002 09:47:34

Busta tu no me conoces, soy un fan tuyo.Me encanta como cantas y tu forma de ser, no te puedes imaginar lo nervioso que estoy, nunca habia sentido tanta admiracion hacia un artista mas en concreto, a un cantante, te he mandado muchisimas cartas y nunca me has contestado soy Carlos Martinez de Torrent un pueblo de Valencia.No se como explicarte toda la admiracion que te tengo, si lo que siente el corazon se pudiera leer entonces tu podrias saber de verdad lo que representas para mi.Eres lo mejor que me a pasado porque tu sin saberlo me has ayudado un monton personalmente.Ahora que Operacion Triunfo a acabado me he hecho de tu club de fans para saber como te va.Vendras a firmar CD's a Valencia??¿Al final tu concierto en VAlencia sera el dia 10 de julio?Un abrazo de todo corazon,te deseo lo mejor.

Object

2255Object24/06/2002 09:47:37

Busta a parte del sueño que estas realizando ¿qué otro sueño te gustaría que se te cumpliera? ¿Entre Gisela y tú existe algo aparte de una buena amistad?es guapísima y super simpática igual que tú hacéis una pareja perfecta. A mi hija le gustaría estar en lugar de Gisela pero solo tiene 11 años pero es junto a mí que soy su madre tu fan nº 1

Object

2256Object24/06/2002 09:48:14

David,sabers que como cantante tus fans te ensalzan a lo mas alto,como actor de cine te ves con futuro?Besos Marian

Object

2257Object24/06/2002 09:55:41

m podrias enviar una postal o foto firmada por ti?

Object

2258Object24/06/2002 09:55:50

Hola David,antes de nada,darte las gracias por el pedazo de disco que nos has regalado,es Genial. Queria preguntarte,¿Que es lo que mas añoras de tu vida anterior y que es lo que menos? gracias por contestar,siempre contigo y arriba campeon. un beso

Object

2259Object24/06/2002 09:56:53

Hola David,antes de nada,darte las gracias por el pedazo de disco que nos has regalado,es Genial. Queria preguntarte,¿Que es lo que mas añoras de tu vida anterior y que es lo que menos? gracias por contestar,siempre contigo y arriba campeon. un beso. Maite

Object

2260Object24/06/2002 09:57:57

Que conciertos vas a dar este verano. Y tengo entendido que cantaras con Verónica. Por que no con Gisela.

Object

2261Object24/06/2002 09:59:19

Sabemos que tu sencillez te ha valido para triunfar,que otra cualidad resaltarias de tu personalidad?Besines Marián.

Object

2262Object24/06/2002 10:03:34

¿como asimilas el fenomeno fan? Una amiga y yo os seguimos desde Almeria hasta casi Murcia detras de vuestro bus, os llevamos churritos al bus en Almeria tras la cancelacion del concierto, a Cuchi Cuchi la llevas loquita ¿que les das?... Nievesfunken-Almeria

Object

2263Object24/06/2002 10:04:45

Bustamante, ¿por qué tu primer single no ha sido algo al estilo de Ave Maria? Creo que Bisbal lleva 100.000 copias mas por esa razon. Tu cancion "Ademas de Ti" no se escucha en discotecas sin embargo "Ave Maria" suena hasta aborrecerla.

Object

2264Object24/06/2002 10:06:45

¿Qué es lo que se siente siendo idolo de masas? La verdad es que imagino que será un cambio radical ¿no?

Object

2265Object24/06/2002 10:07:42

Hola, que tal? Operacion Triunfo me causo impresion de Karaoke, pero tu voz me gusta bastante y se te ve muy emocionado con todo lo que haces. ¿Como llevas la fama?

Object

2266Object24/06/2002 10:07:55

como te va con las chicas? me refiero a novias o amistades

Object

2267Object24/06/2002 10:08:57

si yo te digera que me llamaras lo harias? soy la fan nº 1 bueno mi numero de movil es el 669307592

Object

2268Object24/06/2002 10:09:57

Hola veo que llevas la fama mucho mejor que algunos compañeros tuyos de O.T. como Chenoa que cree que es Madonna o como Bisbal que se cree que es Luis Miguel. ¿En que te diferencias tu para poder seguir siendo normal?

Object

2269Object24/06/2002 10:13:05

Hola: Me gustaria saber en que fechas y en que lugares vas a dar concierto este verano. Se que el 9 de Agosto das un concierto en Medina de Pomar, pero a pesar de que ese ha sido mi pueblo de veraneo toda la vida, este año no puedo estar alli. Porque el 10 de Agosto me caso, asi que mas te vale dar mas conciertos en Julio y Septiembre. Mucha suerte, para mi eres el mejor "cantando". Y si el sabado pudieras ir hasta Portugalete para cantar en mi boda, yo encantada.

Object

2270Object24/06/2002 10:13:31

Array

Object

2271Object24/06/2002 10:15:02

Hola Bustamante, ¿Cual es tu libro favorito o el ultimo que has leido? Ahora supongo que no tendras tiempo para leer. Un salu2

Object

2272Object24/06/2002 10:18:01

Hola Busta,¿te has sentido muy querido en los conciertos que has hecho? Yo estuve en uno y lo hiciste genial. Un beso y suerte. Irene

Object

2273Object24/06/2002 10:19:51

David, ¿cómo te sientes al ver la brutal promoción de David Bisbal tiene en las cadenas más importantes del país (40principales)?

Object

2274Object24/06/2002 10:21:10

Array

Object

2275Object24/06/2002 10:21:56

¿QUe piensas hacer si "todo se acaba"? ¿Volveras a la construccion?

Object

2276Object24/06/2002 10:22:21

¿Que opinion te merece Madonna? UN Saludo

Object

2277Object24/06/2002 10:22:51

hola bustamante , te esperamos en ponferrada el 6 de septiembre me gustaria qu me respondieras mi email es oskarrr14@hotmail.com adios tio y qu te lo pases bien.

Object

2278Object24/06/2002 10:24:19

Despues de ver todo el barullo que se forma a tu alrededor cuando apareces en cualquier sitio ¿Crees que acabaras volviendote, como todas las grandes estrellas, más distante con tus fans? ¿Qué opinas de todo este fenómeno fans?

Object

2279Object24/06/2002 10:25:47

Me gustaria saber si todavia quedan conciertos por cerrar en tu gira y cuando se va ha hacer la presentacion al igual que haran gisela y alejandro en el dia de hoy en una rueda de prensa? ¿cuando se haria tu rueda de prensa?

Object

2280Object24/06/2002 10:27:22

¿Cuando se hara la rueda de prensa de presentacion de tu gira con Vero?tambien me gustaria saber si ya estan cerradas todas las fechas

Object

2281Object24/06/2002 10:30:37

¡Hola titín! Felicitarte lo primero por tu disco y por la gran persona que eres. Te admiro un montón. Vi el programa de "Bustamante y amigos" por cierto como cantaste y bailaste... estuvistes genial. Pero esperaba que te dieran más platinos.¿Por qué no te los dieron si llevas mas de 500.000 copias vendidas? Que sepas que para tu foro eres el mejor.Un besazo. Ruth

Object

2282Object24/06/2002 10:31:08

¿como ves la mentira que nos estan vendiendo sobre ti diciendo que eres un trabajador,cuando no has dado palo al agua en tu vida?creo que tenias que ser mas respetuoso con los que se dejan la espalda en un andamio.

Object

2283Object24/06/2002 10:39:07

Busta: ¿Cuando actuas en Madrid capital o provincia? Deseo ir a verte

Object

2284Object24/06/2002 10:39:18

He escuchado los discos de los tres finalistas de OT, y ésta es mi opinión: Rosa, muy flojo; Bisbal, pasable; Bustamante, decepcionante. Creo que tu disco es sólo diseño, hay muy poca calidad musical. ¿Crees de verdad que habrá algo más que este boom?

Object

2285Object24/06/2002 10:39:48

Tu desarrollo personal, tanto de voz como de forma de estar ha sido impresionante durante tu paso por la académia y después. Si eres el que más ha avanzado ¿donde piensas llegar?

Object

2286Object24/06/2002 10:40:51

Tu club de fans aumenta todos los días. Somos miles y miles los que te seguimos en España, jovenes y mayores. ¿Que mensaje puedes dar a tus fans?

Object

2287Object24/06/2002 10:41:38

David, ¿qué expectativas tienes en cuanto a un segundo disco?

Object

2288Object24/06/2002 10:42:13

APARTE DE CANTAR, CUAL HA SIDO TU APORTACION PARA ESTE DISCO... ¿HAS COMPUESTO ALGUN TEMA O HAS PARTICIPADO EN LA CREACION DE ALGUNO?

Object

2289Object24/06/2002 10:43:44

Tengo a mi compi que pierde los huesitos por tí. ¿Me puedes decir cual es tu secreto? Vamos campeón, suerte y no cambies

Object

2290Object24/06/2002 10:43:47

¿Cómo te sientes con tanto éxito? ¿Te gustaría en algun momento poder recuperar el anonimato y vivir un poco más tranquilo? Mucha suerte!! Te veré en L'Ampolla (Tarragona)

Object

2291Object24/06/2002 10:44:31

Me gustaría saber tu opinión sobre la huelga general del pasado jueves. ¿Trabajaste ese día?

Object

2292Object24/06/2002 10:45:13

Hola!! mi nombre es Laura, y más que una pregunta quiero decirle a mi Busti,,,que no cambie, que es muy grande por dentro y por eso llegará lejos porque eso se refleja en su gran voz,,,por cierto hoy es mi cumple, me encantaria que me mandases un beso,,, gracias

Object

2293Object24/06/2002 10:45:39

¿QUE QUIERES HACER APARTIR DE AHORA, PARA CIMENTAR LO QUE HAS HECHO EN LA ACADEMIA DE O.T. PARA LLEGAR LEJOS EN EL MUNDO DE LA MUSICA?

Object

2294Object24/06/2002 10:45:58

hola busta ¿que sientes ahora despues de tu primer y nuevo disco?el cual me gusta mucho animo.rakel alicante

Object

2295Object24/06/2002 10:46:14

¡Hola David!Soy una paisana tuya a la que le encanta tu CD y que te quiere preguntar una cosa: ¿Qué sentiste cuando te llamaron a la academia para leer un comunicado sobre la paz en el descanso de un concierto de conservatorio? Yo estuve alli y estuviste genial.Besos, Alicia

Object

2296Object24/06/2002 10:46:40

Buenos días Busta. ¿Nos podrías decir como surgió ese gran tema de tu album "No soy un Superman"? La letra es superpegadiza, ¿no crees? Un saludo desde Elda, (Alicante).

Object

2297Object24/06/2002 10:46:47

Eres genial. Por más que busco, no te encuentro ningún defecto. Estoy empezando a sospechar que eres sobrenatural, o que procedes de alguna extraña galaxia, (y más después de tus estelares apariciones en Crónicas Marcianas). Cuéntanos algún defectillo que tengas. ¿Eres consciente de lo especial que eres? Desgraciadamente, no quedan muchos hombres tan auténticos como tú. Besos. Raquel. Madrid

Object

2298Object24/06/2002 10:47:09

¿QUE ES LO QUE QUIERES AHORA QUE HAS LOGRADO EL RECONOCIMIENTO DE MUCHAS PERSONAS POR TU LABOR EN EL DISCO QUE HAS HECHO?

Object

2299Object24/06/2002 10:47:58

CUAL ES EL ULTIMO DISCO QUE TE HAS COMPRADO?

Object

2300Object24/06/2002 10:48:39

HAS CONOCIDO "EL REVERSO TENEBROSO" DE LA INDUSTRIA DISCOGRAFICA?

Object

2301Object24/06/2002 10:49:26

hola david que tal espero que bien, q estes descansando porque el dia 10 de agosto en el campo de futbol vamos a estar ahi contigo, ¿te acuerdas del chico que te dio el regalo en el camerino de canal plus? era mi novio y ahora esta currando y te manda un saludo muy grande, compañero, eso me ha dicho que te dijera, y yo te mando un beso enorme y decirte que eres el mejor y que vas a triunfar muchisimo y que sepas que te queremos mucho, y a ver ¿cuando te vienes por madrid a firmar discos? pq nosotros el dia 9 de agosto vamos "pa yá", a verte, bueno precioso tengo muchisimas cosas que decirte pero tambien hay que dejar que contestes a todo el mundo vale?? bueno

Object

2302Object24/06/2002 10:49:50

hola David. Me llamo Sandra y soy de Potes (Cantabria). No he podido ir al concierto en Torrelavega ni a "Bustamante y amigos" en el Palacio de Festivales. Me gustaría saber cuándo te vas a ir a "hacer las américas". Mucha suerte en tu vida. Un besuco

Object

2303Object24/06/2002 10:49:51

¿La fama te ha obligado a sacrificar muchas cosas?

Object

2304Object24/06/2002 10:51:29

Lo primero darte la enorabuena por tu disco y por el gran corazon que tienes. Soy Carmen tengo 36 años y jamas he sido fans de nadie, mi pregrunta es la siguiente ¿te molesta que te asignen fan de edades superiores a la tuya? besos y enorabuena

Object

2305Object24/06/2002 10:51:35

Hola David. Rosa, Nuria, Chenoa, Vero, Mireia, Geno, Verónica, Natalia, Gisela... ¿Con quien te quedas? ¿Cual fisicamente se aproxima a tu tipo de chica ? Adios guapetonnnnn!!!!

Object

2306Object24/06/2002 10:51:56

Hola david que tal espero que bien, q estes descansadito porque el dia 10 de agosto en el campo de futbol vamos a estar ahi contigo, ¿te acuerdas del chico que te dio el regalo en el camerino de canal plus? es mi novio y ahora esta currando y te manda un saludo muy grande, compañero, eso me ha dicho que te dijera, y yo te mando un beso enorme y decirte que eres el mejor y que vas a triunfar muchisimo y que sepas que te queremos mucho, y a ver ¿cuando te vienes por madrid a firmar discos? pq nosotros el dia 9 de agosto vamos "pa yá", a verte, bueno precioso tengo muchisimas cosas que decirte pero tambien hay que dejar que contestes a todo el mundo vale?? bueno un beso muy grande, TE QUEREMOS, y recuerda BUSTAMANTE DISCO DE DIAMANTE, jeje

Object

2307Object24/06/2002 10:53:03

hola david solo te quiero dar las mayores felicidades de un compinche de venezuela que reside en portugal que gusta mucho de tu magnifica voz la pregunta es la seguinte cuando vienes a portugal haqui tambien los queremos a todos tu e rosita e claro la guapa de nuria e chenoa vengam los esperamos ansiosamente

Object

2308Object24/06/2002 10:53:03

¿Vas a venir a San Sebastian en tu gira? Mucha gente te esperara, yo la que mas. Mandame un saludo desde un programa,para Ane Aiestaran.Tu fan numero 1º

Object

2309Object24/06/2002 10:54:19

busta ,¿que tal fue el paso por las palmas de g.c.? ¿y te dio pena la gente que no llegastes a firmar?¿volveras a firmar a las palmas este año? suerte.norma

Object

2310Object24/06/2002 10:55:09

Hola David komo andamos campeon?? lo de la gira en solitario tiene ke ser agotador, pero komo es lo ke os gusta no se os hará tan pesado no?? Estoy muy cabreado contigo porque en tu gira no vienes a granada!!! commo es eso?? a la tierra de nuestra campeona!! bueno, sera porque no podrias. Pues nada mas que sepas que aki en granada te apoyamos, y ke nunca cambies porque eres el mejor, gracias por ser asi. juliko

Object

2311Object24/06/2002 10:55:28

Hola Guapo. ¿Te va un poco el rollo gay ya que con Alex parece que tengas algo más que amistad y cuando vas a Cronicas no le quitas ojo a Boris? De un gay, gracias encanto.

Object

2312Object24/06/2002 10:55:48

soy jose navarro vivo em portugal pero soy natural de venezuela me gustaria saber cuando vienes a portugal tu y la pandillita de ot... los quieros a todos tambien hago anõs el dia 25 años por eso me identifico mucho contigo

Object

2313Object24/06/2002 10:56:02

Hola Titin me gustaria saber porque mujer luchais Alex y tu en la canción dos hombres y un destino. Un abrazo. Jose de Alcorcon

Object

2314Object24/06/2002 10:57:13

Hola queria saber si te ha gustado participar en el cd de gisela.Jose de alcorcon

Object

2315Object24/06/2002 10:59:54

Hola David, primero decirte que me pareces super sexy, tienes algo que atrae. Me encanta San Vicente y me trae buenos recuerdos de juventud, mis primeras vacaciones "robadas" en el camping con el que hoy es mi marido. Estuve en Vitoria y el concierto fue espectacular, lo pasé genial. fue una lástima y la verdad causó un poco de decepción entre vuestras fans y a mi hija de 13 años que no se os pudiera ver más cerca antes o después del mismo. pero mi pregunta es la siguiente: ¿ vas a venir a firmar tu Cd al Corte Inglés de Bilbao ? me encantaría poder darte un beso y mis mejores deseos de éxito duradero. Suerte - Maite G.

Object

2316Object24/06/2002 11:00:01

Que sientes cuando una persona que no t conoce personalmente te dice"te quiero"?1BESAZO GUAPO,carmen,zgz

Object

2317Object24/06/2002 11:01:19

¿ Qué te pareció la firma de discos en Las Palmas de Gran Canaria ? Gloria.

Object

2318Object24/06/2002 11:05:24

Hola David,soy Tatiana.Yo, la verdad no te voy a preguntar nada relacionado con Gisela,mas que nada porque supongo que te tendran un poco cansado.Solo queria seber que sientes ahora que vas a comenzar tu gira en solitario?(aunque en algunos conciertos te acompañe Vero) Tatiana,Barcelona

Object

2319Object24/06/2002 11:06:17

hola David¡¡q tal estas??lo q quiero decirte no es una pregunta sino q solo quiero darte mi enhorabuena por todo el exito q estas consiguiendo y q sepas q aqui tienes una seguidora y amiga para toda la vida.estuve en lo+plus cuando fuistes,tambien estuve con tu padre charlando y tengo una foto¡¡me llamo mªcarmen y soy de madrid.estoy deseando ir a un concierto tuyo,cuando se ponen a la venta las entradas???muchos besos y mucha suerte¡¡¡¡

Object

2320Object24/06/2002 11:06:54

Hola Bustamante, soy una fan tuya que casi pude conseguir una firma tuya en el programa "Tiempo al tiempo". ¿Cuando irás a firmar a Barcelona? ISABEL , 15 AÑOS

Object

2321Object24/06/2002 11:07:24

hola DAVID soy Ana Bertholett tengo 13 años,y quiero decirte que nunca me ha gustado nadie tanto como tu,ya sea cantantante como buena persona. soy de valencia y he ido a san vicente de la varquera mas de 10 veces casi exclusivamente para verte a ti. y lo unico que he conseguido a sido verte un minuto en tu ventana y conoder a tu abuela que vive en tu calle, a tu madre que es muy simpatica, a tu padre que casi no he hablado con el, a tu tia que tiene un meson, a tu hermano manuel, y a tu tio que conoce un poco a mi padre. dentro de dos semanas me voy otra vez a tu pueblo todo el verano,en unos apartamentos que esta haciendo tu padre en unquera, ESPERO VERTE MUY PRONTO. MUCHOS BESOS.

Object

2322Object24/06/2002 11:07:57

hola Busta!! me alegro de verte de nuevo, siempre con prisas cuando te dejas pasar por el foro corazon :D!!ja no te preocupes ok? te keremos. Bueno ahi va la pregunta... serias capaz de enamorarte de una de tus fans?:) curiosidad ya ves jajaja *2gatita bsitos CATHYHeLL

Object

2323Object24/06/2002 11:09:03

hola encanto!! guapo!! tu foro te kiere!! ahi va la pregunta... serias capaz de enamorarte de una de tusu fans, jajaja curiosidad q tenemos jaja *2gatita Cathyhell te keremos muchoo viva busta!!

Object

2324Object24/06/2002 11:09:21

¿BUSTAMANTE cual ha sido tu paso mas dificil de superar en la academia de operacion triunfo? ¿ y con cual de ellos te has llevado mejor?por favor contesta

Object

2325Object24/06/2002 11:10:04

Bustamante cual fue el momento de la gira mas apasionado para ti? y el momento mas triste o mas infeliz?

Object

2326Object24/06/2002 11:10:45

¡¡puedes venir a requena''

Object

2327Object24/06/2002 11:10:52

hola otra vez Cari! sabias q miles de fans te adoran por como eres?, te pedimos q te conviertas en un artista pero q el busta q era en la obra no se calle, q siga siendo rebelde, risueño e inkieto te keremos a ti!! *2gatita Cathyhell

Object

2328Object24/06/2002 11:11:19

Busta, ¿cómo que no haces el concierto con Gisela? Yo quería ir a veros a los dos. Pilar, 12 años

Object

2329Object24/06/2002 11:11:49

HOLA DAVID!! COMO ESTAS?SOY CLAUDIA DE BARCELONA.QUE SIENTES AHORA QUE TENES UN DISCO EN EL MERCADO?AHORA QUE TODO EL MUNDO TE CONOCE?VAMOS,AHORA QUE ERES FAMOSO O POPULAR?COMO LO VES?TODOS SABEMOS QUE ES ALUCINANTE COMO HAN CAMBIADO VUESTRAS VIDAS EN ESTOS ULTIMOS 9 MESES (MAS O MENOS).CUENTANOS TU EXPERIENCIA. UN BESO MUY GRANDE DE UNA BARCELONESA QUE TE QUIERE CON LOCURA!!!!!! DISFRUTAD DE ESTO TITIN!!!

Object

2330Object24/06/2002 11:12:01

Cuando acabes tu gira de comnciertos, te iras a mexico tengo entendido.. y despues q haras? no me culpes me llaman gatita y ya sabes la curiosidad mato al gat@ jajaja besitos CATHYHELL

Object

2331Object24/06/2002 11:12:24

manolito se cayo en un pozo de San Vicente de la Barquera

Object

2332Object24/06/2002 11:12:49

Los que te queremos y seguimos estamos muy preocupados porque no hay forma de que nadie nos explique por que hay tantas diferencias en cuando a la cantidad de discos vendidos a la fecha. El dia 25 de Mayo, Carlos Lozano te anuncio que habias vendido mas de 500,000 discos en tres dias. De eso ha pasado casi un mes y la cifra no ha variado. Tu mismo dijiste en el programa Noche de Fiesta que la cifras superaban las 700,000. Luego Miguel Gallardo tambien comento que las cifras eran muy superiores a 500,000. De ser asi,por que no te han dado los discos de platino que te deben? Un beso

Object

2333Object24/06/2002 11:13:06

¿que piensas de lo q se va diciendo por ahi de gisela y de ti? ya has dicho q no hay nada q no sea amistad entre vosotros, pero mi niño, jajaja si kieres q dejen de decir cosas no podeis kedaros a un milimetro boca con boca cada vez q cantais la cancion del disco de giselaa!! jaja te kiere Cathyhell

Object

2334Object24/06/2002 11:13:27

hola busta!!!!!soy carmen, no se si te acordaras de mi, te vi en el concierto que diste en Salamanca, con el pase vip. solo queria saber si leiste mi carta, y que cuando vienes a Salamanca a cantqr, q se te hecha de menos. 1 beso.contsta xfa

Object

2335Object24/06/2002 11:13:29

HOLA DAVID ERES EL MEJOR !! TE DECEO LO MEJOR CON TU NUEVO DISCO AUNQUE SIN DUDA NO HACE FALTA QUE TE DECEE LO MEJOR PORQUE YA LO HAS CONCEGUIDO ESOS EXPLENDIDOS COMPAÑEROS DE LA ACADEMIA Y TU DISCO QUE ESE ERA TU SUEÑO BUENO YO TE QUERIA PREGUNTAR SI ¿ VAS A VENIR A DARNOS UN CONCIERTO A TENERIFE O ALGUNA ORTA ISLA ? BESOS PILI TENERIFE ANIMO

Object

2336Object24/06/2002 11:14:35

¿como te sientes mas comodo? con vaqueros o con los pantalones q has estado llevando ultimante? te decimos desde el foro de nuevo q guapo estas con lo q te pongas pero q los vaqueros molan un monton!! tienes 20 años y... mi niño tienes unb don!! te kiere cathyhell *2gatita

Object

2337Object24/06/2002 11:15:10

HOLA DAVID¡¡¡ ¿ALGUNA VEZ HAS SENTIDO QUE TU IMAGEN ESTA SIENDO EXPLOTADA POR LA PUBLICIDAD Y HAS DEJADO DE SENTIRTE TU MISMO? BESOS

Object

2338Object24/06/2002 11:15:36

¿q haces con todos los regalos q te dan los fans? los guardas todos si! pero donde? en tu cuarto no creo q kepan jajaja , ¿te gusto el bañador? jajaja q lo disfrutes y aun hay mas *2gatita Cathyhell

Object

2339Object24/06/2002 11:15:40

¿cuando (que día y mes)daqras un conciereto en este verano en santander?

Object

2340Object24/06/2002 11:16:01

lo mio no es q sea una pregunta si no un agradecimiento por estar aqui y por ser como eres , todas tus fans sabemos q tines algo q muchos no tienen y posabemos q nos quieres y por eso aun te queremos nosotras mas solo quedan 10 dias para cumplir mi sueño verte en persona y encima cantando.. adios .gracias te kiero mucho

Object

2341Object24/06/2002 11:16:05

Realmente cuando miras tus actuaciones, no te resultas patetico y un producto de mercado en lo que tu no tienes ninguna valia??

Object

2342Object24/06/2002 11:16:07

¿hola hola

Object

2343Object24/06/2002 11:16:26

¿David que has sentido al haber ganado o haber sido uno de los tres finalista? me encantaría que me dedicaras un trozo de cualquiera de tus nuevas canciones, me encantas David dedicasela a Carolina Pedroso un beso y espero que sigas siendo el mismo.

Object

2344Object24/06/2002 11:16:28

¿Con cuál canción de las de tu disco, te identificas más? ¿Cómo te gustaría verte en un futuro? Belinda

Object

2345Object24/06/2002 11:16:38

¿te cambiaras alguna vez de peinado?, con lospelos de punta tb estas guapo pero.. el busta q nosotros conocemos a parte de ser un enviado del cielo tiene esa apariencia te keremos como a ti mas te guste vale?, hagas lo q hagas cuenta con nosotros!!*2gatita cathyhell

Object

2346Object24/06/2002 11:16:41

¿Tienes el corazón abierto ante una posible relación conmigo? Firmado: M. Aurora.

Object

2347Object24/06/2002 11:17:28

Hola David,te he seguido durante todo el programa de Operacion Triunfo y te tengo que decir que me encanta tu voz y las canciones de tu nuevo disco.Queria preguntarte:¿Que ha supuesto para ti tu salto a la fama?.¿en que ha cambiado tu vida?.Gracias y un beso.te lo mereces todo. vero

Object

2348Object24/06/2002 11:17:40

¿cantaras en tus conciertos canciones a medias con vero, como la de kiero vivir la vida maandote? eske es mi cancion favorita :) , en ingles es preciosa pero con vuestras voces no tiene comparacion te kiere Cathyhell *2gatita

Object

2349Object24/06/2002 11:18:51

david!!!!!soy Carmen de portalmix, te vi en el concierto de Salamanca, x el pase q me toco y eso. fui la q te entrege un peluche de caballo y un collar, xq no te lo has puesto???me encantaría q alguna vez te lo pusieras. Fue un honor conocerte. Espero q leyeras la carta. 1 besazo. TQ

Object

2350Object24/06/2002 11:19:53

Hola David,queria felicitarte por tu disco y preguntarte cual es o son las canciones que mas te gustan de tu disco,y tambien quería saber si vienes a Sevilla a actuar.muchos besos.Inma.

Object

2351Object24/06/2002 11:20:24

¿David vas a dar algun concierto en Valladolid o en Palencia? es que soy de Palencia y me encantaría que fueses a Palencia para poder conocerte en persona un beso de parte de Carolina de Palencia

Object

2352Object24/06/2002 11:22:17

Hola me llamo eva, soy de salamanca y me gustaría saber si vas a venir a dar algún concierto aquí.

Object

2353Object24/06/2002 11:22:32

hola busta¿como te va en tu carrera de cantante que has deseado siempre?un saludo desde tenerife y dale un beso de mi parte a GISELA

Object

2354Object24/06/2002 11:24:24

David:se ha estado escuchando por la radio que el martes pasado ibas a la Piramide musical del Corte ingles de Valencia a la firma de tu disco ¿porque no vinistes? contesta por favor o nos podrias llamar a casa mi numero es 961171691 me llamo Jessica y el de Mayka es 961173391 nos haria mucha ilusion gracias y un BESO muy fuerte

Object

2355Object24/06/2002 11:26:15

Hola wapisimo!me llamo Lidia y soy una superfan tuya!me gaste mi saldo llamando a O.T. para k ganases!me gustaria saber como te sientes ahora k has cumplido tu sueño.Sigue asi campeón!!BSOS!!!!

Object

2356Object24/06/2002 11:26:34

¿Con ese arte y saber estar que tienes encima de un escenario, no te han propuesto hacer cine? Belinda

Object

2357Object24/06/2002 11:27:09

Crees que cuando comience la nueva edición de OT la gente os seguirá apoyando a vosotros? o de lo contrario empezará a mimar a los nuevos concursantes? Besotes Noe

Object

2358Object24/06/2002 11:27:21

¿Qué sentiste cuando llegó el último concierto de la gira de Operación Triunfo? Belinda

Object

2359Object24/06/2002 11:27:26

Enhorabuena David.Mi mujer, mis hijas y yo estamos encantados con tu CD.¿cual es tu canción favorita?

Object

2360Object24/06/2002 11:28:47

Volvereis a cantar los 16 juntos en alguna otra ocasión? Si no me equivoco Juan ha hecho una canción para los 16 en su disco. Un abrazo Noe

Object

2361Object24/06/2002 11:28:55

hola busta!!!!!soy carmen no cre oq te acuerdes de mi, te vi en Salamanca con el pase vip, y te regale n peluche, un collar y una carta, espero q te gustara todo. Después de verte no tengo mucho q preguntar solo q suerte, q eres un artista como la copa de un pino. Y q se te quiere mas de lo q te puedes pensar. 1 besazo TQ

Object

2362Object24/06/2002 11:28:59

Cuales son tus planes profesionales despues del verano?

Object

2363Object24/06/2002 11:29:18

¿que te parece la nueva reforma de desempleo?.¿Es para echarse a llorar o no?

Object

2364Object24/06/2002 11:29:26

Cuánto tiempo hace que no os veis todos? no os da cierta nostalgia?. Mil besos Noe

Object

2365Object24/06/2002 11:30:00

Hola wapo!!! soy una fan tuya de valencia. Enhorabuena por tu primer trabajo, es fantastico. Cuando vas a venir a firmar discos a Valencia?? Aqui te queremos mucho, estaremos apoyandote en todos los conciertos de la comunidad, porque tanto como cantante y como persona eres genial. 1 beso

Object

2366Object24/06/2002 11:32:41

Buenos días Busta, me gustaría saber, el número de copias que realmente llevas vendidas, ya que en la lista de AFIVE tienes 500.000 copias desde el primer día. Ah, y que te parece el apoyo exagerado que la productora hace a otros de tus compañeros, mientras que de otros casi ni se acuerda. Besos de una paisanuca.

Object

2367Object24/06/2002 11:33:27

HOLA DAVID COMO ESTAS ESPERO QUE BIEN SOY UNA FANS TUYA DE MADRID ME LLAMO MARI CARMEN QUE SEPAS QUE TE QUIERO MUCHISIMO CUANDO VIENES A MADRID QUE TENGO MUCHAS GANAS DE CONOCERTE CUANDO VAS HACER FIRMA DE DISCOS EN MADRID BESITOS GORDOS ERES EL MEJOR DEL MUNDO ENHORABUENA POR TUS EXITOS TE LO MERECES TODO BESITOS GORDOS

Object

2368Object24/06/2002 11:33:34

has pensado en ir a dar un concierto o de vacaciones a ibiza?

Object

2369Object24/06/2002 11:37:22

Qué piensa de la Huelga General del pasado 20 de junio, paraste?

Object

2370Object24/06/2002 11:39:58

¿esperabas lo conseguido hasta ahora? ¿esto no te cambiara verdad?

Object

2371Object24/06/2002 11:39:59

no te dio verguenza posar desnudo el la foto. ¿vas a venir en concierto a madrid?

Object

2372Object24/06/2002 11:41:22

Para ti q es mas importante el amor o la amistad??? besos alba de santiago

Object

2373Object24/06/2002 11:41:54

Me gustaria que me comentaras un poco la frase siguiente que muchos artistas, entre ellos Calamaro proclaman abiertamente " los verdaderos piratas son las discograficas". ¿que tienes que decir al respecto?¿que opinas sobre el tema? Me gusta mucho tu disco. F

Object

2374Object24/06/2002 11:44:33

has hecho tu primera firma de discos en las islas canarias,¿como te has sentido?cuentanos un poco como fue para los que no estuvimos. You are the best in the world! Besitos! Amalia,Marbella

Object

2375Object24/06/2002 11:44:53

Hola Busta!¿Te gustan mas las canciones rápidas o lentas? Sandra.

Object

2376Object24/06/2002 11:44:56

hola bustamante una pregunta ¿cuando vuelves a san sebastian?David de san sebastian?

Object

2377Object24/06/2002 11:45:09

Qué estarías dispuesto a hacer por amor?? Lucia_22. Valencia

Object

2378Object24/06/2002 11:45:49

Hola Busta!¿Con qué edad empezó tu pasión por la música?Gracias!Eres el mejor!Sandra.

Object

2379Object24/06/2002 11:45:58

hace dos meses, fui a San vicente de la Varquera para darle una carta a la familia de Busta, con el fin de que se la entregaran a él, pero no me has contestado, ¿que ha pasado?

Object

2380Object24/06/2002 11:46:11

David, que es lo que mas te a gustado de Operacion Triunfo i de Eurovision? (Hoko)

Object

2381Object24/06/2002 11:46:16

Hola busta!¿Tienes algo con Gisela?Marina BCN

Object

2382Object24/06/2002 11:46:41

hola bustamante una pregunta ¿cuando vuelves a san sebastian? David de san sebastian

Object

2383Object24/06/2002 11:46:53

¿ Como te sientes ahora despues del triunfo que has tenido ?

Object

2384Object24/06/2002 11:47:10

Hola Busta. Sólo quería decirte que eres uno de mis mejores. Mi pregunta es muy sencilla.¿Qué tal llevas la subida tan rápida al éxito? ¿Estás contento con tu disco? Espero que sí. Un besazo. Eli.

Object

2385Object24/06/2002 11:47:48

Te gusta dar el punto ese hortera que tienes?

Object

2386Object24/06/2002 11:48:21

David, eres un tio espendo, desde el primer dia que te vi sabia que ibas a ser el mejor y el ganador. Estoy deseando que llegue el 10 de Julio para verte en concierto, eres genial. Te quiere una fan " YOLANDA CALERO "

Object

2387Object24/06/2002 11:48:43

¿Que es lo que hicieron tua padres en especial para darte esa carita de angel que tienes?

Object

2388Object24/06/2002 11:48:47

hola Titín!!!!!!!cuando entras en el foro....realmente eres tú el q escribes??? por q te vas a Barcelona a vivir!!!!!no te puedes venir pa Sevilla???esta mu bien,si kieres te puedes kedar en mi casa,jejejeje.un besazo:María (15 pa 16),Sevilla.ERES LO MÁS.EL MEJOR,ARTISTAAAA,GUAPOOOOOOOOOOOOOOOOOOOO!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Object

2389Object24/06/2002 11:49:04

hola david antes ya te he enviado un mensaje pero se me ha olvidado una cosa! soy sandra en el foro OT.the best i keria decirte k gisela iba a mi cole las salesianas i si le podias decir k todo el colegio la estamos apoyando!! i k canta como una perla i k me encanta!! muchos besos para ti busta ya k eres mi favorito!! TE KIERO!!!

Object

2390Object24/06/2002 11:49:17

¿ES VERDAD QUE VAS A DAR UN CONCIERTO EN POLA DE SIERO EL 16 DE JULIO?

Object

2391Object24/06/2002 11:49:51

Prefieres los chicos o las chicas ?

Object

2392Object24/06/2002 11:49:52

¿Qe son las fritangas?

Object

2393Object24/06/2002 11:50:30

busta yo no es por ser pesada pero¿estas saliendo con Gisela ?, es porque haceis muy buena pareja y además sois mis dos favoritos.por cierto me encanta tu disco, está guapísismo.Adios un besote.

Object

2394Object24/06/2002 11:50:44

¿Porque te has pasado llorando durante todo el tiempo que has pasado en la Academia?

Object

2395Object24/06/2002 11:50:55

Tus fans te adoramos, pero como somos tantos, no queremos que te sientas acosado por nuestro apoyo. A veces te consideramos demasiado como algo nuestro. ¿Podemos hacer algo por tí? ¿Necesitas más respeto por tu vida privada? ¿Te sientes agobiado?

Object

2396Object24/06/2002 11:50:55

Pero niño,mírate un poco a tí mismo en el espejo o mejor escuchate y dime que no eres más que un subproducto de la canción mal empaquetado. Sois todos la bazofia de la música, el pan barato para el pueblo inculto.Jose, la Tierra.

Object

2397Object24/06/2002 11:51:02

Sabemos que antes te gustaba Gisela, ¿y ya no? ¿no sientes nada por ella?

Object

2398Object24/06/2002 11:51:16

Hola David, ¿que tal te sientes con tu nueva vida? Muchos besos de Vanesa, que te quiere mucho.

Object

2399Object24/06/2002 11:51:27

el nombre de amantes?

Object

2400Object24/06/2002 11:51:28

Buenos dias. Me parece que lo vuestro (Operacion Triunfo) es puro Marketing, como lo de Korea en el Mundial, interesa puntualmente al poder, y se prestigia y se promociona con una campanya desmesurada a todas luces. Que crees tu?. Gracias y un Saludo.

Object

2401Object24/06/2002 11:51:35

holaBustamante soy una gran fan tulla de barcelona llamada laura te quiero mas que a mi propia vida, lo dava todo por ti, tu disco es genial, estaba muy mal porque pense que mi sueño nunca se iba a hacer realidad,que es conozerte, pero gracias a ti y tu foro no e perdido la esperanza y se que el dia de conozerte llegara, pero igualmente lo paso muy mal porque te quiero ver y con solo treze años no puedo ir a ningun sitio para verte!!! que sepas que mientras escribo esto estoy llorando de lo feliz que me haces con tu cd, cuando el mundo se me viene encima, tu disco, y tu me haceis seguir adelante, muchas gracias por ser cmo eres, cuando vas a venir a la diagonal de barcelona a firmar discos? estoy muy ìnpaciente por conozerte, contestame porfabor me arias muy feliz, bueno, ya lo haces siendo como eres. con mi apollo vas a contar siempre! te kiero muchisimo, mas que a mi propia vida. gracias, muchos besos de tu fan nomber one!

Object

2402Object24/06/2002 11:51:39

David ¿vendras a zaragoza a firmar disco? ¿no te decepciono no ir a eurovision con cantante y no de coro? eres el mejor

Object

2403Object24/06/2002 11:52:38

¿Que cancion es la que mas te gusta? Un abrazo muy fuerte de una logroñesa.

Object

2404Object24/06/2002 11:52:44

Busta: eres el mejor y superas incluso a tus ídolos. ¿Que sentiste al cantar con Luis Fonsi? Que duo más bonito.

Object

2405Object24/06/2002 11:52:52

Hola David,mi nombre es Rocio y te escribo desde Córdoba;quería saber que tal te encuentras en este nuevo mundo en el que te mueves y qué esperas de nosotr@s, tus fans?.Besos, eres un encanto.

Object

2406Object24/06/2002 11:53:13

¿Qué autores eligirías para tu siguiente disco?

Object

2407Object24/06/2002 11:53:16

¿cual es el mejor recuerdo te llevas de la academia?

Object

2408Object24/06/2002 11:54:04

Cuantos conciertos tienes este verano?

Object

2409Object24/06/2002 11:54:07

hoal Busta quiero decirte que eres el mejor, pero yo te quiero hacer una pregunta:¿Estás saliendo con Gisela? no es por nada pero es que haceis buena pareja y además sois mis dos favoritos. Con respecto a tu disco me encanta , todas las canciones son bonitas. Un besote Busta.

Object

2410Object24/06/2002 11:54:25

¿En qué ciudad te lo has pasado mejor? ¿Crees que tendras disco de diamante?

Object

2411Object24/06/2002 11:54:54

¡Maravilloso tu disco paisanuco!Espero que todo te vaya genial porque te lo mereces.Me gustaría saber cómo va a ser el espectáculo con el que nos vas a sorprender este verano. Te esperamos en Castro, Santandes, San Vicente y Santoña. muchas gracias por todo, de corazón. Silvia ADIC

Object

2412Object24/06/2002 11:55:24

HOLA david te vuelvo a escribir un mensaje pero este no es de agradecimiento si no q aora si q es una pregunat vas a venir a pamplona el 4 de julio y ya tengo tu entrada , como cantas en el mismo concierto q vero no sabemos si cantareis alguna cancion juntos como queiro vivir la vida amanote o si tb cantareis caciones de operacion triunfo ademas de las de vuestros albumes besos tkm crack_eli

Object

2413Object24/06/2002 11:55:33

Hola guapetón, yo te quería preguntar que si vas a venir de gira a Tenerife porque he mirado en algunas listas y no viene. Espero que si porque aquí hay mucha gente que te quiere.adios

Object

2414Object24/06/2002 11:55:47

Hola David, solo decirte que eres un soplo de viento fresco en el mundo de la música. Queríamos preguntarte si tienes conocimiento de los lugares de la gira del verano, ¿Donde los podemos encortar para intentar seguirte? Un beso y animo Juani y Viky - Murcia

Object

2415Object24/06/2002 11:56:01

HOLA GUAPÍÍÍSSSIMOOO!!!!!soy María de Sevilla(15 pa 16).q haces con todos lo e-mails y eso q te dan???con quien estás viviendo en Barcelona??? echas mucho de menos a tus papis???eres el mejor.te quiero, te apoyo.FORO DE BUSTA al poderrrrr.cuándo vas a salir en Sabor a ti???q ya se ha caducao!!!!q te lo pases bien,un besazo,te adoro,vida míaaaa!!!!!!

Object

2416Object24/06/2002 11:56:24

AUPA TITIN, ERES EL MEJOR SOMOS DOS MEGAFANS TUYAS D SANTANDER, YO SOY D SANVI, TE QUERIAMOS PREGUNTAR QUE ES LO QUE HARIAS POR HACER FELIZ A UNA DE TUS MILES D FANS, UN BESAZO CAMPEÓN, TE QUEREMOS MUCHO: ISA Y VANE (SHYNA Y KILLAA)

Object

2417Object24/06/2002 11:56:25

¿Cual fue la cancion que mas te gusto de las que cantaste en las galas de o.t.? Vanesa de Logroño.

Object

2418Object24/06/2002 11:56:52

QUERIDO TITÍN: SOY HEIDI DE TARRAGONA. QUIERO QUE SEPAS QUE, AL IGUAL QUE TU CANCIÓN, "ADEMÁS DE TI NO HAY MÁS". MI PREGUNTA ES LA SIGUIENTE: ¿CÚAL ES TU FUENTE DE INSPIRACIÓN CUANDO CANTAS?. LA MÍA SIEMPRE ERES TÚ. BESOS!!

Object

2419Object24/06/2002 11:56:57

David ¿qué sentiste en el escenario del Palacio de Festivales?. Me emocioné al ver de nuevo la sala Argenta, porque ahí gané yo en el 93 el primer premio nacional de acordeón. Un abrazo. Amalio (Navalcarnero-Madrid)

Object

2420Object24/06/2002 11:57:02

busta soy una gran fan tuya y me gustaria saber que cuando hagas la gira ¿vendras a zaragoza?¿cuando?aqui te esperamos todos

Object

2421Object24/06/2002 11:57:22

¿Te has planteado alguna vez afeitarte la cabeza y dejarte bigotes de 10 centimetros de largo para parecerte a Fu-Manchú? R.

Object

2422Object24/06/2002 11:57:29

Hola David, Mi nombre es Marco y soy Portugues residente en Monaco. Segui desd el principio Operacion Triunfo y te queria felicitar a ti por la magnifica voz que tienes y por seres como eres. Continua assi que llegaras muy lejos. Hace dos semanas estuve en Barcelona para visitar mi novia y la primera cosa que hay hecho fue comprar tu CD. Increible!!!! como diz tu amigo Bisbal PS: Perdon se esta escrito mitad en Portugues y mitad en castellano. Un abraco, Marco

Object

2423Object24/06/2002 11:57:39

como se puede ser tan hijo de puta y vivir del dinerito de las niñitas?¿?¿?, no t da vergüenza?¿

Object

2424Object24/06/2002 11:57:44

hola bustamante una pregunta quien te parece de las chicas que se merecia ganar de guapa

Object

2425Object24/06/2002 11:58:01

eres yonki?¿?¿?¿ BE YONKI!!!!

Object

2426Object24/06/2002 11:58:04

¿Cual fue el peor momento que pasaste en la academia? Una hornillera que te quiere un monton.

Object

2427Object24/06/2002 11:58:11

hola, soy laura de barcelona, aki te dejo mis numeros, 935741118 o 650587651, me podrias llamar algun dia?? bueno se que es inposible, pero cmo te qiero tanto no pierdo la esperanza, y puede que un dia me suene el movil, y oiga tu maravillosa voz, lo dava todo por ti, por poderte decir lo mucho que te qiero, por estar un segundo a tu lado. gracias por compartir esa pedazo de voz con todos nosotros, gracias de corazon! te kiero mucho

Object

2428Object24/06/2002 11:58:41

Si queremos escrivirte alguna carta y te la queremos mandar...¿a donde podemos acerlo?

Object

2429Object24/06/2002 11:58:42

Q OPINAS DE LA COPROFAGIA?¿ Y DE LA NECROFILIA??? T LO HAS HECHO ALGUNA VEZ CON 2 PERROS PASTOR ALEMÁN??¿

Object

2430Object24/06/2002 11:58:59

me gustaria que me firmara tu gran disco personalmente pero; ¿Me podrias envia una foto actual dedicada para adrian a esta direccion pokeadri@eresmas.com? por favor. Que eres el mejor

Object

2431Object24/06/2002 11:59:10

ola nos reservas alguna sorpresa para el concierto??????? espero q sea muy bonito y q disfrutemos todos estoy segura q sera un gran espectaculo

Object

2432Object24/06/2002 11:59:17

bustamante alguna vez vas a venir a huelva el hipercor dime cundo porfavor escriveme a mi correo estefaniabueno@ono.com

Object

2433Object24/06/2002 11:59:51

¿ es verdad que eres novio de Gisela?

Object

2434Object24/06/2002 11:59:51

¿Como te sientes con tu nuevo disco? Paula y Susana, tus mellizas de San roman.

Object

2435Object24/06/2002 12:00:23

DAVID, DE TODAS TUS COMPAÑERAS DE LA ACADEMIA, CON CUAL DE ELLAS PODRIAS HABER TENIDO UNA HISTORIA DE AMOR.

Object

2436Object24/06/2002 12:00:28

hola David, eres un artista como la copa de un pino y lo sabes, ¿es verdad que te querian quitar el tatuaje porque no pegaba con la musica que cantas? Un beso, tienes todo nuestro apoyo.

Object

2437Object24/06/2002 12:00:32

Me han dicho que todos los chicos de OT teneis un movil para que os llamen los fans.¿Es verdad?¿cual es el tuyo?

Object

2438Object24/06/2002 12:01:27

hola david lo 1º que tal estas? bueno yo queria preguntarte si hechas mucho de menos a tu tierra ya que con la promocion del disco no puedes ir mucho por alli la hechas mucho de menos?? oye por cierto sabes algo de tus ventas ??? es verdad que ya as vendido 1500000?????? y por que tu discografia no te da el diamante?? bueno yo ya me despido solo una cosa viva san vicente de la barquera!!! ole! muchos besos guapo. paz_busta

Object

2439Object24/06/2002 12:02:03

hola!!!!!somos Eva y Bea de Palma de Mallorca.Primero de todo queremos felicitarte por el peazo de disco que tienes!!!!!¿Que te parece que te comparen tanto con Bisbal??Un besazo muy muy grande guapo!!!

Object

2440Object24/06/2002 12:02:23

Busta, ya me enterado que no tienes programada ninguna gala en Zaragoza. Te gustaría venir por aquí. Nos encantaría tenerte en el Pilar, y si fuera por mí, te nombraría pregonero de las Fiestas. Me encantaría que vinieses por aki.Lara Zgz

Object

2441Object24/06/2002 12:02:24

¿Te has planteado la posibilidad de compaginar la música y la interpretación? (Ej: Miguel Bosé lo ha hecho). Eres muy expresivo y tienes facilidad para transmitir sentimientos, por lo que pienso que se te daría bien la interpretación.

Object

2442Object24/06/2002 12:02:51

Solo te quiero decir que siempre tendras mi apoyo, y que me gustaria algun dia conocerte. Cuando cantas me haces sentir muchos sentimientos. Muchos besos y abrazos de Vanesa Fernandez.

Object

2443Object24/06/2002 12:02:58

Ante todo, Enhorabuena por el discazo que has grabado!. ¿Tu éxito te sigue pareciendo un sueño, o ya eres consciente de que estás ahí porque vales mucho y lo que haces gusta?

Object

2444Object24/06/2002 12:03:21

Has llegado al corazon de todos y todas. ¿Crees que sacara otro fabuloso disco? Adrian. Zaragoza. ¿vendras a firmar discos?

Object

2445Object24/06/2002 12:03:52

David, ¿que piensas cuando ves el revuelo que se monta alla por donde pasas?. Enhorabuena por tu disco. Consuelo, Madrid.

Object

2446Object24/06/2002 12:04:04

No crees que OT es una vergonzosa trivialización del esfuerzo y los años que hay dedicar para llagar a ser músico ?. Luis

Object

2447Object24/06/2002 12:04:05

Hola David. Me encantan tus canciones y me vuelve loca tu estilazo. ¡Estás como un tren! ¿Qué opinión te merece la pasada jornada de huelga? Me gustaría saber si eres uno de esos seis españoles de cada diez que cree que el diálogo social está "muerto". Un beso muy fuerte.

Object

2448Object24/06/2002 12:04:12

dicen ke eres más ke amigo de gisela, ¿es cierto?,dinos la verdad

Object

2449Object24/06/2002 12:04:17

hola David!!!!!somos dos chicas de Palma de Mallorca.¿cual sera tu proximo single???ademas de ti ya esta arrasando y seguro que el proximo tambien!!!un besazo muy grande guapeton!!Eva y Bea

Object

2450Object24/06/2002 12:05:05

Hola Busta, ¿eres consciente de que tu sensibilidad ha llegado a los corazones de todos tus fans? Suerte en tu carrera. Neftali (10 años) La Linea.

Object

2451Object24/06/2002 12:05:29

somos 2 chicas de tu club de fans dinos si tienes previsto en tu gira acercarte por Almansa(Albacete). contesta. besos de chelo y Belen Tomás

Object

2452Object24/06/2002 12:06:13

hola guapeton!!!somos dos fans tuyas de Albacete que nos tenemos que fastidiar sin verte este verano pero bueno ahí va la pregunta¿te ha sentado mal que te llamasen llorón? besos y abrazos de: virginia y sandra

Object

2453Object24/06/2002 12:06:14

Hola Busta, he aprendido mucho de ti ¿hs aprendido algo de tus fans? Un beso Suerte! Soy Neftali (La Linea) 10 añitoa

Object

2454Object24/06/2002 12:06:15

hola bustamante ante todo felicitaciones por tu disco que es muy bueno, yo soy cantabro(de astillero)y queria saber si eres del racing porque me gustaria que en el sardinero te harian un homenaje entonces eres del racing? hasta luego

Object

2455Object24/06/2002 12:07:41

Hola David posiblemente hable en nombre de todos los fans tuyos pero me gustaria saber ¿por qué no vienes a Zaragoza para hacer un concierto? en Zaragoza te queremos mucho eres el mejor.

Object

2456Object24/06/2002 12:08:26

David,¿Crees que todo esto sera la fiebre de un año o por lo contario piensas que os mantendreis en la musica todos muchos años?, personalmente creo que vales mucho y q durareis no todos , pero al menos 5,mantendreis en la cumbre

Object

2457Object24/06/2002 12:08:52

DAVID:¿Tu crees que con todo lo que te ha pasado en estos ultimos meses puedes cambiar tu caracter? Porfavor no cambies para nada. Te quiere con locura MARIA PEREZ NICOLAS

Object

2458Object24/06/2002 12:09:13

Quisiera saber si en su gira de verano va a estar en Madrid capital.

Object

2459Object24/06/2002 12:09:23

Hola David soy veronica de oviedo,solo darte la enhorabuena por el peazo de disco que tienes ya que es precioso.¿Cuando tienes pensado venir a oviedo a firmar el disco? por aqui tenemos muchisimas ganas de verte ya que eres el mejor.un beso compañeruuu

Object

2460Object24/06/2002 12:09:48

Hola David, me podias decir ya que nadie lo ha hecho cuantos discos llevas vendidos y si eres diamante por que no te lo han dado ya, un saludo campeón eres el mejor Parada, Torrelavega

Object

2461Object24/06/2002 12:09:49

Bustamante, sientes cuando la gente te idolatra tanto e incluso te dice que le has devuelto hasta las ganas y la ilusión de vivir? Y cuando cientos de personas corean tu nombre al unisono? Gracias te deseo lo mejor!!! Mucha suerte en tu carrera en solitario!!!

Object

2462Object24/06/2002 12:09:53

QUERIDO TITÍN: SOY HEIDI DE TARRAGONA. QUIERO QUE SEPAS QUE, AL IGUAL QUE TU CANCIÓN, "ADEMÁS DE TI, NO HAY MÁS". MI PREGUNTA ES ESTA: ¿CÚAL ES TU FUENTE DE INSPIRACIÓN CUANDO CANTAS? LA MÍA SIEMPRE ERES TU. BESOS!!

Object

2463Object24/06/2002 12:09:55

¿Quién crees en tu más sincera opinión que triunfará más y se mantendrá en lo más alto? Abrazos al mejor de los Artistas.

Object

2464Object24/06/2002 12:10:12

Mi madre, que padece Esclerosis Múltiple, recupera la sonrisa y la alegría con sólo escuchar tu precioso color de voz, y te queremos tanto que viajaremos desde Coruña hasta San Vicente en Agosto para verte cantar, y quien sabe, incluso conocerte. Te queremos AMIGO. Isabelita y su mamá.

Object

2465Object24/06/2002 12:10:12

hola! ¿crees que la gente se olvidara un poco de vosotros cuando saquen la 2º edicion de operacion triunfo? un besazo de luisa para david bustamante !eres el mejor! no cambies nunca.

Object

2466Object24/06/2002 12:10:32

¿Qué nota le darías desde un punto de vista crítico a los discos de los demás y, por supuesto, al tuyo? Saludos.

Object

2467Object24/06/2002 12:10:33

soy de barcelona y me llamo laura, eres el mejor del mundo, mi vida sin ti no tiene ningun sentido, lo dava todo pore star un segundo a tu lado, por poderte expresafr lo mucho que te quiero, espero mi dia de conozerte, muy impaciente, es verdadque el dia 3 o 4 vienes a firmar discos a sabadell? que sepas que yo y mi amiga rakel em0s escrito una instancia para traerte a nuestro pueblo, pero no se si van a poder.... porque haces tan pocos conciertos en barcelona? porque te quiero tanto!!!! Si tengo que morir que sea en tus brazos lentamente beso tras beso y hasta que llegue la muerte, seguir contigo y hasta el sueño retenerme!! por un beso de tu boca yo me muero! te kiero, contestame porfabor

Object

2468Object24/06/2002 12:10:33

Hola david te escribo desde asturias para desearte lo mejor en esta carrera que empiezas.¿vas a venir por asturias de gira no? esperamos verte por aqui pronto un beso muy fuerte

Object

2469Object24/06/2002 12:10:43

Hola David, soy María, de Asturias, y nos conocimos en el pase vip de Santiago, ¿te acuerdas?¿Te gustaron la camiseta y el colgante que te regalé? Mi mayor ilusión es vértelo puesto, hazlo por mi alguna vez, me harías muy feliz. Besos.

Object

2470Object24/06/2002 12:10:54

Array

Object

2471Object24/06/2002 12:11:21

¿Por qué una gira con Verónica y no con tu mejor pareja artística, que es Gisela?Abrazos guapo. Una gallega

Object

2472Object24/06/2002 12:11:29

hola david me gustaria decirte que me llamras urgentemente con tu amigo manu hbalo casi todos los dias llamame 625458736 un beso alicia

Object

2473Object24/06/2002 12:12:00

Hola David! Desde que entraste en O.T me has enamamorado!Me gustaria saber qual fue el nombre de la primera mujer que amaste como ninguna otra?Y cantas en la ducha?? adios besos

Object

2474Object24/06/2002 12:12:07

¿Crees que se te está dando una promoción justa con respecto a otros compañeros de Academia? Mis más sinceros abrazos. Besos dulces y traviesos. Chiqui

Object

2475Object24/06/2002 12:12:17

Aparte de triunfar en la música, q ya lo has conseguido, tienes algún sueño por alcanzar??. Lucya22. valecia. un beso wapo y no cambies.

Object

2476Object24/06/2002 12:12:26

Bustamante, que sientes cuando la gente te idolatra tanto e incluso te dice que le has devuelto hasta las ganas y la ilusión de vivir? Y cuando cientos de personas corean tu nombre al unisono en los conciertos? Gracias te deseo lo mejor!!! Mucha suerte en tu carrera en solitario!!!

Object

2477Object24/06/2002 12:12:32

Hola David, mi mayor sueño hubiera sido que grabaras el dueto con Sergio Dalma. ¿Que pasó al final para que no lo grabarais?Un beso de una adicta a tu foro, Blanca.

Object

2478Object24/06/2002 12:12:34

Seamos claros ¿Cuántas copias llevas vendidas? ¿Por qué siempre dicen más de medio millón y no actualizan las cifras o quieren mostrar la realidad? Yo intuyo por donde andas.... Besos DULCES y TRAVIESOS. Te quiero, Isabel

Object

2479Object24/06/2002 12:12:44

¿por qué no quieres venir a Granada en concierto?Aquí hay muchas fans tuyas que están recogiendo firmas para llevarlas al ayuntamiento y puedas venir.

Object

2480Object24/06/2002 12:12:55

me gustaria hacerle unas preguntas a ese cacho de bombon y de voz que hoy visita los 40. 1-¿que supone para ti la gira que vas a comenzar?¿la gira incluira otras canciones que no sean de tu disco?m gustaria felicitarte por tu disco y decirte q estoy muy triste pk te has olvidado d granada en tu gira.pilar.

Object

2481Object24/06/2002 12:13:34

HOLA DAVID: EN PRIMER LUGAR QUIERO FELICITARTE POR EL PEDAZO DE DISCO QUE NOS HAS REGALADO A TUS FANS. ES GENIAL, ME ENCANTA, LO ESCUCHO A TODAS HORAS Y NO ME CANSA PARA NADA. ENHORABUENA!!! PARA MI ERES Y SIEMPRE SERÁS EL MEJOR!!! ¿A QUIEN SE LO HAS DEDICADO EN ESPECIAL?

Object

2482Object24/06/2002 12:13:34

David, ahora que eres famoso, cambiarias esto por volver a estar como antes y pasar mas tiempo con tu familia? la debes d hechar muchisimo de menos...

Object

2483Object24/06/2002 12:13:48

DAVID:Esto no es una pregunta, la verdad es que lo que te pido es un favor,no nos haria mas ilusion a mi mejor amiga y a mi que nos mandases un beso.Nos llamamos MARIA y ANA GABRIELA somos de Logroño, estuvimos en el concierto que disteis los 16, y fue el mejor de nuestra vida.BESAZOS

Object

2484Object24/06/2002 12:13:57

¿cuantos años tienes?

Object

2485Object24/06/2002 12:14:31

hola David!!! soy Lucía de zaragoza. ¿que te parece hacer la gira junto a veronica? eres el mejor no cambies nunca!!! muak!!!

Object

2486Object24/06/2002 12:15:32

hola busta=guapisimo soy una fans vas a venir y me gustaria que filmases ¿filmas en todos sitios?¿cual es el disco de tus compañeros que mas te gusta?¿hay rollito con gisela o es solo amistad?mi habitacion esta llena d posters tuyos bueno un beso guapo simpatico y m encanta como eres chao

Object

2487Object24/06/2002 12:15:35

Buenas tardes Busta. ¿Cuál es la canción qué más te gusta de tu disco? ¿Qué es lo que menos te gusta de ser famoso? ¿Tienes el tiempo libre que tú pensabas que ibas a tener? Un saludo. Enrique (Tenerife). Haber si nos das una alegría y te acercas por nuestra isla.

Object

2488Object24/06/2002 12:15:39

No crees Bustamante que es demasiado las condiciones de exclusividad por 4 años con la Academia y los porcentajes que se llevan por vuetsro trabajo como representantes

Object

2489Object24/06/2002 12:16:15

hola David soy Lucía de zaragoza . ¿estas orgulloso con tu disco? a mi me encanta! no paro de escucharlo! es alucinante! . mil besos! muak! .

Object

2490Object24/06/2002 12:16:50

hola David, felicitarte por tu disco es excelente en su totalidad, mi pregunta es ¿En tu segundo disco seguiras teniendo como productor a Miguel Gallardo o solo ha sido una colaboración esporadica? gracias y sigue que te apoyamos siempre

Object

2491Object24/06/2002 12:16:52

Buenos días, David. En la Academia OT no tuvísteis mucho tiempo de asimilar todo lo que aprendísteis. ¿cuál es tu proyecto de aprendizaje y formación para los próximos años? . Me gustaría que te consolidaras en el futuro dentro del Panorama musical español. Tu voz es privilegiada. Un abrazo.

Object

2492Object24/06/2002 12:17:11

David es evidente que tu éxito ha cambiado tu vida, ¿Ha cambiado también la de tu familia, padres y hermanos? Un saludo Asturiano, Alex.

Object

2493Object24/06/2002 12:17:16

Te molestamos las fans cuando queremos estar un poquito contigo antes de los conciertos

Object

2494Object24/06/2002 12:17:20

Busta el sabado estuviste en Las Palmas, hiciste una firma de discos, te sorprendio la cantidad de gente q te esperaba? Gracias por lo q me dijiste de la pulsera.Desy.Te queremos.

Object

2495Object24/06/2002 12:17:26

Hola David,¿porque pasas una vez solamente por Barcelona en tu gira?

Object

2496Object24/06/2002 12:17:30

CUAL CREES QUE ES EL SELLO QUE TE IDENTIFICA Y TE HACE DIFERENTE A OTROS CANTANTES, BUSTAMANTE?

Object

2497Object24/06/2002 12:17:44

Hola Busta!!!!!!!! Te quiero pedir un favor no cambies nunca ni psicologicamente ni fisicamente(porque estas mas bueno que los bizcochos que hace mi abuela) Me despido. AUPA SAN VICENTE DE LA BARQUERA!!!!!! BESAZOS Y ABRAZOTES.MARIA (LOGROÑO)

Object

2498Object24/06/2002 12:17:57

cuando estuviste en Madrid te deje una carta con dos flores de papel hechas por mi en la furgoneta, te las dieron? espero que si, muchas suerte en la gira y espero verte muy pronto, un besazo guapo

Object

2499Object24/06/2002 12:17:59

HOLA DAVID: EN PRIMER LUGAR QUIERO FELICITARTE POR EL PEDAZO DE DISCO QUE NOS HAS REGALADO A TUS FANS. ES GENIAL, ME ENCANTA, LO ESCUCHO A TODAS HORAS Y NO ME CANSA PARA NADA. ENHORABUENA!!! PARA MI ERES Y SIEMPRE SERÁS EL MEJOR!!! (HEIDI DE TARRAGONA) ¿A QUIEN SE LO HAS DEDICADO EN ESPECIAL?

Object

2500Object24/06/2002 12:18:02

perdon me llamo montse y soy de manresa me he dejado mi nombre en la pregunta sobre miguel gallardo

Object

2501Object24/06/2002 12:18:16

mandamos un saludo desde sexoteca.com nos gusta mucho tu musica y sobre todo el estilo, piensas que la musica española tiene salida internacionalmente ¿?

Object

2502Object24/06/2002 12:18:24

David, te molesta tener fans que superen los 35. gracias

Object

2503Object24/06/2002 12:18:26

¿Qué resaltarías y qué rechazarias de tu vida actual?. Raquel Santander

Object

2504Object24/06/2002 12:18:28

Soy de barcelona, me llamo laura, y te quiero mucho, mi vida sin ti no tiene sentido, si no te conozco me muero, es mi sueño y lo kiero hacer realidad, por eso te digo, cuando te voy a poder ocnozer en barcelona? aki te dejo mis numeros 935741118 y 650587651 se que es inposible, pero asi me arias la mas feliz del mundo te quiero mas que a nadie en el mundo, mas que a mi propia vida contestame porfabor, te quiero, gracias

Object

2505Object24/06/2002 12:18:59

hola busta! ¿que piensas cuando llegas a un plato y ves q l@s fans estasn alli para apoyarte?, ¿ q somos tu foro para ti? ANA (cathyhell) *2gatita te keremos guapoooo!!

Object

2506Object24/06/2002 12:19:11

hola busta!lo primero es felicitarte x tu diisco,tu voz y x ti.eres muy grande!!!!!!lo segundo es preguntarte q con quien te hubiese gustado hacer algunos conciertos de no ser con vero.y lo tercero es decirte q los granainos estamos muy triste pk tu gira no pasa x aqui y me gustaria q cuando puedas agas un hueco y te pases x aki.seramuy feliz.mil besos,pilar,granada.

Object

2507Object24/06/2002 12:19:12

¿vas a pasar las vacaciones en nuestra tierra?

Object

2508Object24/06/2002 12:20:36

hola david!! Lo primero felicitarte por tu trabajo ya q es impresionante! lo segundo decirte q como va a ser tu gira es decir habra mucho baile, muchas canciones meloticas...en cada sitio va a ser igual??¿?¿besos mariona de barcelona

Object

2509Object24/06/2002 12:20:42

´¿podrias enamorarte de una fan?

Object

2510Object24/06/2002 12:21:07

davicillo ¿que piensas acerca de la publicidad de tu disco q te estan haciendo tus fans?, y de los piketes q a la fuerza kieren formar algunos programas para q seais competidores entre vosotros? ana (cathyhell) malaga *2gatita

Object

2511Object24/06/2002 12:21:35

¿Quien te peina? Porque aunque estás guapo de cualquier manera, casi todas tus fans pensamos que estabas más favorecido con el pelo algo más corto y con el pelo "natural" o para atrás (como lo llevabas en las galas de O.T.) Un beso, Cecilia

Object

2512Object24/06/2002 12:21:40

bustamante, que sentiste cando tu cd estubo en tus manos? yo muchisima alegria, te kieor muchisimo, laura barcelona

Object

2513Object24/06/2002 12:21:53

Hola guapisimo,como estas David?¿Sabes lo que una fan puede llegar a sentir por una persona como tu?Yo dejaba mi vida por ti.Te quiero.Raquel Velez

Object

2514Object24/06/2002 12:21:59

Hola Bustamante. ¿Cual es el disco que mas te gusta de todos tus ex-compañeros? Y mojate, no me salgas con que "son estilos diferentes" jejeje.

Object

2515Object24/06/2002 12:21:59

Hola David, soy Pablo de Dos Hermanas (sevilla). ¿Como decidiste llamar para participar en los casting de seleccion de O.T?, ¿Cual ha sido tu peor momento dentro de la academia?. Un abrazo y te deseo mucha suerte!!.

Object

2516Object24/06/2002 12:22:38

Bustamante, a ver si te mojas un poquito, de todos los sitios en los que has cantado hasta la fecha,,¿cual es el que m´ñas te ha impresionado? much suerte chaval.¡¡y enhorabuena por tu disco.-Rulfo

Object

2517Object24/06/2002 12:22:47

Hola, wapo, soy Noelia una Francesita, queria pedirte si algun dia vendras aqui a Paris a dar un pekeño concierto? Y tu disco esta genial por cierto cual cancion te gusta mas? Un besazo. Te kiere Noe, la francesita!

Object

2518Object24/06/2002 12:22:55

David,¿cuando vas a pasar por Barcelona en la firma de autografos?Todos te esperamos.TE QUIERO.Raquel Velez

Object

2519Object24/06/2002 12:23:04

david:¿podrias enamorarte de una fan? ews para saber si me puedo hacer alguna que otra ilusion muchos besos de maria (malaga)

Object

2520Object24/06/2002 12:23:10

Hola!Me gustaria saber, q sienten tus amigos al verte ahi arriba??? porque a mi me emocionaria ver a mi amigo ahi. Bueno, mucha suerte, campeon. Rebeca, Torrelavega (Cantabria)

Object

2521Object24/06/2002 12:23:17

David estamos ansiosas porque nos firmes el disco! Sabes ya alguna fecha de firmas??? Muchos besos dulces y traviesos!!! Clara (Valencia)

Object

2522Object24/06/2002 12:23:18

Hola compañeru,que tal? Espero que te vaya muy bien en tu carrera ya que te lo mereces todo eso y mas.Esperamos verte pronto por oviedo, no queremos a chayanne queremos a nuestro busta que es el mejor;¿Que cancion es la que mas te gusta del disco?

Object

2523Object24/06/2002 12:23:32

Hola David lo primero es agradecerte ese pedazo de disco que has sacado ya que no tiene desperdicio de nada y lo segundo es preguntarte porqué en la gala de Bustamante y amigos no hubo ningún representante de tu casa discográfica, yo creo que era importante que ellos hubiesen hecho alguna aportación sobre tu disco ¿tu no lo crees asi? espero y deseo que esta carrera sea muy frúctifera para ti. De Yolanda (Barcelona)

Object

2524Object24/06/2002 12:23:54

David ¿crees que los participantes de Op. Triunfo II tendrán tanta suerte como vosotros?? saludos.

Object

2525Object24/06/2002 12:24:01

david¿q sientes cuando uno se tus fans te abraza con tanta ilusion? espero porderlo sentir yo algun dia!! esperando ese momento ANA (CATHYHELL malaga) *2gatita

Object

2526Object24/06/2002 12:24:03

hola david!! TENGO Q IR A SAN VICENTE ESTE VERANO PQ ME A CAUSADO INTERES Y ME A INTRIGADO CON TUS PALABRAS! Y MI PREGUNTA SERIA ME PUEDES RECOMENDAR ALGUN HOTEL O PENSION!?¿?¿? GRACIAS Y MUCHOS BESOS GUAPO!MARIONA (BARCELONA)

Object

2527Object24/06/2002 12:24:21

Hola David,con decirte que eres mi vida te digo todo.Mi pregunta es: ¿Sabes lo que una fan puede llegar a sentir por una persona como tu?Raquel Velez

Object

2528Object24/06/2002 12:24:37

David, desde Israel te seguimos. Nos encanta tu voz y tu personalidad y sabemos que que seguiras subiendo si te sigues preparando. Vas a seguir con los estudios de musica? Un beso fuerte

Object

2529Object24/06/2002 12:24:40

hola david: te propongo un reto.Ir a tomar un cafe contigo cuando vengas el 5 de julio a palamós.Seria un sueño.Te he conocido como artista desearía conocerte como persona.(mi mobil lo tiene tu tia,(mujer de Javier,que por cierto es un cielo.) UN BESAZO , LLÁMAME VENGA!!!PORFI (1 MINUTITO) LIDIA (BARCELONA)

Object

2530Object24/06/2002 12:25:03

David, anteriormente te he formulado dos preguntas, pero no han sido aceptadas, voy a intentar otra: Si un dia te levantases por la mañana, y descubrieses que tu mano derecha se ha convertido en un arenque, ¿que harias si tuvieses mucha hambre? ¿irias al medico? o ¿te comerias tu mano/arenque? Un beso enorme, guapeton, Manolo(Madrid).

Object

2531Object24/06/2002 12:25:06

Hola david te escribo desde oviedo,para decirte que por aqui se te quiere mucho, no queremos ver a chayanne te queremos ver a ti que eres el mejor;¿con que cancion de tu disco te identificas mas?

Object

2532Object24/06/2002 12:25:14

QUERIDO DAVID: ERES LO MEJOR QUE ME HA PASADO....¿A QUIEN LE DIRÍAS TÚ ESTA MISMA FRASE? BESOS Y FELICIDADES POR TU DISCO. PARA MI, ADEMÁS DE TI, NO HAY MÁS. TQ. HEIDI (TARRAGONA)

Object

2533Object24/06/2002 12:25:20

enhorabuena por tu CD y felicidades por la gala de Santander, el directo fué magnifico. He visto el programa de la gira y veo que no tienes dias libres para venir a Cantabria ¿soportaras estar tanto tiempo separado de TODAS las personas a las que quieres, podrás verlas entre concierto y concierto, verás a Gisela?

Object

2534Object24/06/2002 12:25:23

Array

Object

2535Object24/06/2002 12:25:26

Hola David Bustamante!Eres lo mejor que me ha pasado en mi vida.¿Vas a pasar a firmar discos a Barcelona?Raquel Velez

Object

2536Object24/06/2002 12:25:34

Hola David:o) Uno de mis sueños hubiera sido que hubieras hecho el dueto con Sergio Dalma. ¿Que pasó al final para que no lo hicierais??Eres el mejor, un besote guapetón, una adicta a tu foro, Blanca.

Object

2537Object24/06/2002 12:25:36

si te ofrecieran un papel en una película donde tengas que desnudarte, lo harías?

Object

2538Object24/06/2002 12:25:57

David, en primer lugar quiero felicitarte por tu disco y después quiero preguntarte por qué no cantas nunca "Duda de amor" cuando, para muchos, entre los que me incluyo, es una de las grandes baladas de tu cd. Un besazo y sigue trabajando como hasta ahora, que llegarás muy alto. Cecilia, de Madrid

Object

2539Object24/06/2002 12:26:15

hola busta!! vas a hacer algo especial durante tu gira con vero?no se, alguna cancion q no sea del disco o algo asi ANA (malaga) CATHYHELL *2gatita

Object

2540Object24/06/2002 12:26:25

Hola Busty: ¿sabes lo que una fan puede llegar a sentir por una persona como tu? Yo daria hasta mi vida.Te quiero.Raquel Velez

Object

2541Object24/06/2002 12:26:29

es verdad que estas con gisela?

Object

2542Object24/06/2002 12:26:48

Hola David, ¿Como decidiste trabajar en el mundo del espectaculo?, ¿Cual ha sido el peor momento de tu carrera?. Un abrazo y te deseo mucha suerte!!.

Object

2543Object24/06/2002 12:26:52

David lo primero de todo decirte que eres un artistazo como la copa de un pino, y segundo mi pregunta es: .¿Qué tal llevas la subida tan rápida al éxito? ¿Estás contento con tu disco?Raquel (barcelona)

Object

2544Object24/06/2002 12:26:54

HOLA DAVID!!! TE GUSTA LA FAMA!?¿?¿ O TE INCOMODA?¿. CREES Q ES EL PRECIO Q TIENES Q PAGAR!?¿MARIONA (BARCELONA) BESOS Y SIGUE ASI!!!

Object

2545Object24/06/2002 12:26:57

David, ¿Tienes miedo a que este BOOM se acabe? Seguiras con mi apoyo.Raquel Velez

Object

2546Object24/06/2002 12:27:04

Buenos días, David. En la Academia OT no tuvísteis mucho tiempo de asimilar todo lo que aprendísteis. ¿cuál es tu proyecto de aprendizaje y formación para los próximos años? . Un saludo.

Object

2547Object24/06/2002 12:27:10

hola david!! ¿Como era y es tu chica ideal? sin rodeos, como te la has imaginado desde pequeño?, crees q alguna de tusu fans es ella? ANA (malaga) CATHYHELL *2gatita

Object

2548Object24/06/2002 12:27:15

¿Cual es tu opinión sobre el conflicto armado en Chechenia? Ernesto (Córdoba)

Object

2549Object24/06/2002 12:27:19

cuando vienes a sansevastia

Object

2550Object24/06/2002 12:27:19

hola BUSTA!! que tal?? soy un fan tuyo al igual que de la vero y de gis, me parece que ellas dos son ahora: "dos mujeres con un mismo destino (tu)" jejeje, bueno te queria preguntar ¿Porque no haces un concierto tu y la vero en Septiembre o Agosto en TENERIFE? es que aquí nos quedamos desconsolados. Un fan Tinerfeño.

Object

2551Object24/06/2002 12:27:23

Hola David!¿Tienes novia?Te quiero.Raquel Velez

Object

2552Object24/06/2002 12:27:40

hola guapo, como crees que va a resultar tu gira con Vero? Elena(Madrid)

Object

2553Object24/06/2002 12:28:13

Hola David.¿Porque es tan dificil realizar un sueño?¿Porque es tan dificil poder tocarte?Miles de personas dariamos la vida por ti. Raquel Velez. Te quiero

Object

2554Object24/06/2002 12:28:15

hola david, soy Elena de Badajoz, y me gustaria saber si vas a venir a firmar discos aqui porque yo quiero que vengas besitos

Object

2555Object24/06/2002 12:28:36

QUERIDO TITÍN: SEGÚN MI OPINIÓN MERECIAÍS UN MEJOR PUESTO EN EL FESTIVAL DE EUROVISIÓN. PERSONALMENTE, ¿TE SENTISTE UN POCO DECEPCIONADO? BESOS DE TU FAN Nº 1 (HEIDI-TARRAGONA) AHHHH!!!ENHORABUENA POR EL DISCO, ES GENIAL!!!!!

Object

2556Object24/06/2002 12:28:45

david!! te gustan los animales? q pensrias si te regalasen una mascota? ANA ( gatita CATHYHELL malaga)

Object

2557Object24/06/2002 12:28:46

¿porque no intentas nada con Gisela? a todo el mundo le encantaria

Object

2558Object24/06/2002 12:28:49

cual a sido para ti el mejor concierto q has dado durante la gira?( aparte de tu tierra) te deseamos lo mejor,siempre estaremos contigo aunq no estes tan arriba como ahora pero pensamos q estaras ahi.Arriba Busty!! Azahara y MªLuisa (MURCIA)

Object

2559Object24/06/2002 12:28:53

david, ¿no crees que hay mucha gente mejor preparada que tu en el mundo de la musica y que lleva mas tiempo que tu que no se merece ver a un personaje como tu triunfando?

Object

2560Object24/06/2002 12:29:20

hola guapisimo cual es el dico que mas t gusta d tus compis ?te sentiste agusto con tus productoresdel disco t trataron bien?un besazo d tu fans q deseo q llegue ya el dia 25 d agosto

Object

2561Object24/06/2002 12:29:20

Hola David,soy Raquel Velez de Barcelona.¿Sabes lo que una fan puede llegar a sentir por ti?TEQUIERO

Object

2562Object24/06/2002 12:29:26

Hola David! somos Lucía y Fani de zaragoza. Nos encanta la canción que cantas con Alex, ¿volverías a cantar con el en algún otro disco? sois los mejores!! un besazo!!

Object

2563Object24/06/2002 12:29:30

Tienes muchos seguidores fuera de España, piensas hacer una gira internacional?. Que paises visitarias? Te queremos mucho

Object

2564Object24/06/2002 12:29:32

HOLA DAVID!! ¿COMO VAS A DEVOLVER TODO EL AMOR Q TE ESTAMOS DANDO TODAS TUS FANS?¿?¿ POR CIERTO GRACIAS POR PONERTE MI PULSERA EN LA RUEDA D PRENSA DESPUES D EUROVISION(UNA D BOLITAS DE MADERA)!ERES UNA ESTRELLA Q SIEMPRE VA A BRILLAR!!BESOS MARIONA DE BARCELONA

Object

2565Object24/06/2002 12:29:46

Hola David ¿te sientes agobiado por toda la gente que se mueve a tu alrededor, por haber perdido tu anonimato? Si es así espero que te compense el cariño, el respeto y la admiración de las personas que, como yo, creemos en tí y te apoyamos día a día. Un fuerte abrazo y "a por todas" Cecilia, Madrid

Object

2566Object24/06/2002 12:29:47

HOLA DAVID MI PREGUNTA ES: ¿TE GUSTARIA ENAMORARTE AHORA O QUIERES ESPERAR UN POCO PARA DEDICARTE MÁS A TU TRABAJO?UN BESAZO.LIDIA (BARCELONA).

Object

2567Object24/06/2002 12:29:48

BUSTA!! q sientes cuando miles de fans t epersiguen de concierto en concierto y vas a donde kiera q te lleven? ANA CATHYHELL MALAGA *2gatita

Object

2568Object24/06/2002 12:29:49

¿Creés que venderás con tu 2º CD tantos como con el 1º? Espero que sí. Eres de los que más han mejorado en este tiempo. Un saludo desde Eibar, se despide un amigo del primo de tu madre, Sierra. Fdo.: Gorka

Object

2569Object24/06/2002 12:29:51

Hola David, ¿que sientes al saber que yo daria mi vida por ti? Raquel Velez. TKM

Object

2570Object24/06/2002 12:30:13

Hola David me llamo Lorena vivo en Sueca (Valencia).¿ Crees que en algún momento de tu carrera, te podria pasar como a otros actores, cantantes, que se les ha relaclíonado con personas sólo por seguir adelante con su sueño. Sin sentir nada por ellos? - ¿ Crees que tu carrera es o puede llegar a ser compatible con tu Familia, Amigos o en un Futuro con tu mujer y los hijos?: - ¿ De que fomar a cambiado tu vida?.Quiero decir si tu personalidad ha cambiado

Object

2571Object24/06/2002 12:30:20

david ¿PORQUE NO HACES LA GIRA CON GISELA EN VEZ DE CON VERO '

Object

2572Object24/06/2002 12:30:23

Me llamo Patricia,tengo 21 años y soy de La Coruña.Me gustaria saber cual va a ser tu proximo single del disco. Y decirte que sigue como eres que eres de lo mejorcito que hay como artista y tambien como persona.Y felicitarte por tu fabulosos disco que cuando lo empiezas a escuchar no puedes dejarlo.Un besazo de una gallega que te quiere mucho.

Object

2573Object24/06/2002 12:30:30

Hola Cielo, ¿Te doleria si yo muriera por ti, por no poder verte? Te quiero. Raquel Velez.

Object

2574Object24/06/2002 12:30:50

¿Eres consciente de los sentimientos tan opuestos que provocas en la gente? O te aman o te odian. ¿Por qué crees que es?

Object

2575Object24/06/2002 12:30:53

Estimado David. Tengo 15 años, y estudio música en el Conservatorio de San Sebastián. Pues resulta que mi profesora de armonía fue profesora tuya de solfeo hace dos años, en San Vicente de la Barquera, si no me equivoco. Esta coincidencia me llamó la atención, y solo quería que lo supieras. Muchas gracias.

Object

2576Object24/06/2002 12:30:55

Hola Titin, algun dia volveras a Sanvi a vivir alli con tu familia y amigos? Un besito, Tq. Noelia, la Francesita

Object

2577Object24/06/2002 12:30:57

BUSTA!! ¿ Pq no te dejan cuando te encuentras fans y estas de viaje o vas a algun lado o simplemente cuando acabas una gala y bajas a saludar q le des besos y abarzos a todas las personas q te gustaria? ANA CATHYHELL*2 gatita MALAGA

Object

2578Object24/06/2002 12:31:02

Hola ¿¿Es cierto k perdiste la virginidad del culo en una timba de poker con paco porras torrente y jordi pujol?? Gracias eres junto a Boris el maricón mas famoso de TV.

Object

2579Object24/06/2002 12:31:26

Hola David, el sabado estuvistes en Las Palmas actuando con otros artistas. Allí se congrego mucha gente y quedo claro que principalmente acudieron alli por verte a ti. ¿Que te parece el hecho de ser tu la estrella de la noche entre tanto artista? Alexis (Las Palmas)

Object

2580Object24/06/2002 12:31:27

hola david soy africa de valencia y me gustaria saver si vendras antes del concierto a firmar discos?muchas gracias y espero que todo te vaya igual de bien!!!!besoos.VALENCIA TE QUIERE

Object

2581Object24/06/2002 12:31:51

No te ofendas, pero ¿no consideras que te estas "prostituyendo" vendiendo discos con fotos de desnudos?Parece más bien que vendes un cuerpo y un nombre más que música ¿alguna vez pensaste que sucedería esto mientras estabas en la academia? Te lo pregunto a ti, como se lo preguntaría a cualquiera de tus compañeros, porque el otro día vi unas fotos en una revista de Bisbal, que me dieron vergüenza ajena. Gracias

Object

2582Object24/06/2002 12:31:56

Hola Cielo, ¿Te doleria si yo muriera por ti, por no poder verte?¿Sabes lo que puede llegar a sentir una fan por ti?¿Vas a pasar por Barcelona en la firma de discos?¿Cuando? Te quiero. Raquel Velez.

Object

2583Object24/06/2002 12:31:59

Hola David guapo!! soy ana de malaga (CATHYHeLL)¿que piensas de la emision en television de la gala BUSTAMANTE Y AMIGOs?besos encanto

Object

2584Object24/06/2002 12:32:02

bustamante cuanto por meterte un palo lleno de matekilla por el culo??

Object

2585Object24/06/2002 12:32:06

Hola David, ¿Te doleria si yo muriera por ti, por no poder verte?¿Sabes lo que puede llegar a sentir una fan por ti?¿Vas a pasar por Barcelona en la firma de discos?¿Cuando? Te quiero. Raquel Velez.

Object

2586Object24/06/2002 12:32:31

como se tomaron tus padres eso de k dejases de estudiar? rakel salamanca eres el mejor... no cambies apo

Object

2587Object24/06/2002 12:32:33

Hola Busta!!!creo que nunca podras imaginar la admiracion que siento por ti ,eres lo mejor que me ha pasado musical y sobretodo personalmente, porque tu sin saberlo me has ayudado muchisimo. Mi pregunta es:que sentiste cuando Gisela te propuso hacer el duo con ella de "nuestro mundo" que por cierto es preciosa?¿y que se te paso por la cabeza cuando te nominaron en la academia por primera vez?.Eres el mejor sigue asi y no cambies porque aunque algunas personas te critiquen tus fans van a estar siempre ahi por que eres EL MEJOR.Un abrazo de corazon de Carlos "El Valenciano".

Object

2588Object24/06/2002 12:32:37

hola guapisimo sufres al ver q muchas de tus fans duerman en la calle para verte a ti?d tu fans q espero impacientemente q llegue el dia 25 d agosto un besazoooo

Object

2589Object24/06/2002 12:32:45

Hola David, ¿Que es lo que mas te ha gustado de todo lo que te esta pasando y lo que menos? Te quiero. Raquel Velez

Object

2590Object24/06/2002 12:32:50

¿Quién crees en tu más sincera opinión que triunfará más y se mantendrá en lo más alto? Abrazos al mejor de los Artistas.

Object

2591Object24/06/2002 12:32:52

David, mucha gente ha dicho que los participantes de Operacion Triunfo no sois mas que mocos pegados en el sofa de la vida, ¿que tienes que decir tu a eso? Rumplestinky (Madrid)

Object

2592Object24/06/2002 12:32:52

hola!!! bustamante, felicidades por tu disco mi pregunta es que aras cuando acabe tu gira???? gracias muxos besos de sonia,lorena,carmen,mari de Mallorca...

Object

2593Object24/06/2002 12:33:07

donde vas a pasar las vacaciones

Object

2594Object24/06/2002 12:33:09

Hola DAVID!!:¿En q piensas cuando estas encima del escenario y miras al cielo?.Besitos!!.Ana(Punta Umbria)

Object

2595Object24/06/2002 12:33:19

Array

Object

2596Object24/06/2002 12:33:29

Buenas David: ¿Te imaginabas tanto éxito cuando te encaminabas a Oviedo al 1º casting? ¿Pensabas que tenías opciones de entrar a la Academia? Un saludo. Fdo.: Gorka (Eibar)

Object

2597Object24/06/2002 12:33:34

!Hola David!Si pudieras ambiar algo de este mundo , ¿Que cambiarias?

Object

2598Object24/06/2002 12:33:35

HOLA DAVID: SOY HEIDI DE TARRAGONA Y ANTES DE NADA QUERÍA DARTE LAS GRACIAS POR TODO, EN ESPECIAL POR EL REGALO DEL DISCO QUE NOS HAS HECHO A LAS FANS. MI PREGUNTA ES ESTA: ¿HAS PENSADO ALGUNA VEZ DEDICARTE AL MUNDO DE LA PASARELA COMO MODELO? NO LO DIGO POR NADA PERO ES QUE POSANDO, IGUAL QUE CANTANDO, ERES EL MEJOR!!! EN LAS FOTOS DEL DISCO ESTÁS QUE TE SALES -SOBRETODO EN LA ÚLTIMA, MI PREFERIDA-

Object

2599Object24/06/2002 12:33:46

¿Estás conforme con el tipo de música que cantas en el disco? ¿No te gustaría intentar otro tipo de música más clásica? Sería estupendo. Un abrazo. Eli

Object

2600Object24/06/2002 12:33:53

HOLA,NUNCA EN MI VIDA HE TENIDO UN POSTER EN MI HABITACION,PERO TU ME HAS LLEVADO A DECORAR LAS PAREDES CON EL TUYO.Y AHORA PIENSO,QUE QUIZAS LLEGARÁ UN DIA EN EL QUE NOS CONOZCAMOS PERSONALMENTE.ERES UN SER HUMANO INCREIBLE,DE VERDAD,ESPERO PODER IR A VERTE A PONFERRADA,AUNQUE NO LO TENGO FACIL.UN ABRAZO

Object

2601Object24/06/2002 12:33:54

Hola David, ¿que piensas de todo esto? Te quiero. Raquel Velez

Object

2602Object24/06/2002 12:33:55

hola guapisimo!!!!!!! eres el mejor de todos los que estaban en la academia, me encanta tu disco y tu pueblo ¡¡¡SAN VICENTE DE LA BARQUERA!!!me gustaria saber si vendras a Badajoz algun dia, es que querria verte. un beso Elena

Object

2603Object24/06/2002 12:33:59

hola Busta, ahora estaras en contra de la pirateria peroa k seguro k tienes algun disco pirateao k opinas sobre esto? rakel

Object

2604Object24/06/2002 12:34:01

A ver... tú eres tan imbécil o te lo haces?

Object

2605Object24/06/2002 12:34:04

HOLA DAVID BUSTAMENTE SOY FATIMA QUE LE DIRIAS A TODA LA GENTE QUE VA A EMPEZAR ESTE AÑO OPERACION TRIUNFO BESOS

Object

2606Object24/06/2002 12:34:08

David, el otro día te vimos bailar mu requetebien. ¿Te gusta bailar y cantar a la vez? No crees que siempre diran que "imitas" a otros. Un beso y sigue así campeón. Lucia. Madrid

Object

2607Object24/06/2002 12:34:18

¿Que piensas de todo esto? Raquel Velez

Object

2608Object24/06/2002 12:34:19

hola guapeton!me gustaria preguntarte q es lo q llevas peor d la fama,ademas d estar lejos de tu familia.loq yo llevo peor es q no pases x granada en tu gira.x ultimo decirte q me gusta mucho q te emociones x cada cosa q te pasa xq yo tambien me emociono contigo.tienes 1 gran corazon.en granada se te quiere,besos pilar.

Object

2609Object24/06/2002 12:34:31

Porque de la imagen de ser un@s tont@s de bote mal manipulad@s

Object

2610Object24/06/2002 12:34:33

Hola wapeton. Quería preguntarte que porque no se repitió el concierto que se suspendió en valencia ni se hizo nada al respecto? Me puedes hacer un favor. Esque hoy es mi cumple ( 15 años) y me gustaría que me felicitaras. Besos.¡¡ ERES EL MEJOR!!

Object

2611Object24/06/2002 12:34:39

hola Busty! ¿cómo podemos contactar tus fans contigo? porque cada vez que vas a algun sitio vas lleno de gorilas,somos dos chicas de 19 años de murcia q opinan q eres un artistazo. esperamos tu visita. te queremos guapisimo.un beso: Azahara y MªLuisa

Object

2612Object24/06/2002 12:34:43

hola guapisimo que piensas al ver lo rapido q ha cambiado tu vida antes un albañil y ahora un fantastico y buenisimo cantante q la gente duerme en la calle por verte?un besazo simpatico

Object

2613Object24/06/2002 12:34:45

¿Piensas como mucha gente cree que tu no deberias haber sido el tercer ganador de Operación triunfo, y por lo tanto que tu puesto lo tendria que haber ocupado Chenoa?

Object

2614Object24/06/2002 12:34:52

Seamos claros ¿Cuántas copias llevas vendidas? ¿Por qué siempre dicen más de medio millón y no actualizan las cifras o quieren mostrar la realidad? Yo intuyo por donde andas.... Besos DULCES y TRAVIESOS. Te quiero, Isabel(La Coruña)

Object

2615Object24/06/2002 12:34:58

Hola David, ¿Porque eres tan perfecto? Raquel Velez.Te quiero

Object

2616Object24/06/2002 12:34:59

busta¿cuando bas a sacar tu proximo disco?enlo conciertos que tienes pensado hacer por toda españa¿bas a sacar al escenario a alguna fan?¿contestas a todas las cartas que los/as fans te envian?espero que me saludes en el concierto de valencia el dia 10.un besazo cielo

Object

2617Object24/06/2002 12:35:06

DAVID QUE LE PIDES ALA VIDA AHORA QUE ESTAS EN LO MAS ALTO?. uN BESITO

Object

2618Object24/06/2002 12:35:11

¿Crees q OT ha sido un paso adelante en la música española o por el contrario ha terminado con ella? Ernesto HJ (Córdoba)

Object

2619Object24/06/2002 12:35:12

¡Hola David! ¿Cuál fue para ti el mejor momento del especial Bustamante y amigos que se celebro en el Palacio de Festivales de Santander?Alicia, Lucía, Bea, Eva, Paula,Cristina,Gema, Isabel y Elena (Santander)

Object

2620Object24/06/2002 12:35:20

Siempre voy a tu pueblo y a Comillas a veranear , ¿Que es lo que mas te gusta de tu pueblo?A mi todo!!David de Palencia.

Object

2621Object24/06/2002 12:35:23

BUENAS DAVID soy una fan tuya de valencia y me gustaria saver si vas a venir a firmar discos a VALENCIA antes de el concierto.TE ESTAMOS ESPERANDO IMPACIENTES.un beso y VALENCIA TE QUIERE!!!!

Object

2622Object24/06/2002 12:35:24

¿Operacion tarufo? ¿Spain is livin a huelgarechon?

Object

2623Object24/06/2002 12:35:24

Hola busta me llamo gisela y soy de gerona me gustaria saber que si a parte de actuar en gerona irás al hipercor o algun sitio a firmar discos.

Object

2624Object24/06/2002 12:35:28

Titin, iras a visitar a los participantes de la nueva edicion de OT a la academia? eso dijiste un dia hablando con Vero! Un besazo TQMMM Noelia (Paris)

Object

2625Object24/06/2002 12:35:30

Hola David ¿Que crees que has aprendido en este tiempo? y ¿Que te hemos aportado a nivel personal tus fans? Muchas gracias por ser como eres,tus sueños son nuestros sueños,un beso Nuria(Amandita)

Object

2626Object24/06/2002 12:35:32

hola david!!!!!!!!!!soy Carmen, esguri q no te acuerdas de mi, te vi en Salamanca, en el concieto de OT, y la verdad nunca olvido ese dia, y fue genial. Quería saber si aún conservas el peluche q te regale(q era un caballo)y el collar con la carta. Espero con impaciencia tu 2ºdisco ¿¿ya estas pensando en el??un besazo tq!!

Object

2627Object24/06/2002 12:35:32

David ¿te sabria mal que te hiciesen una parodia? te lo pregunto porque yo te estoy haciendo una y no quisiera hecer algo y te supiera mal, soy Mª Jose Camus de caudete ALBACETE.

Object

2628Object24/06/2002 12:35:36

¿Que nos dirias a todas las fans que quieren dar la vida por ti?Te quiero.Raquel Velez

Object

2629Object24/06/2002 12:35:42

Hola David,¿te has llevado alguna decepción personal (sobre alguien) desde que has entrado en el mundo de la canción?.Gracias,Salva

Object

2630Object24/06/2002 12:35:45

Hola wapeton. Quería preguntarte que porque no se repitió el concierto que se suspendió en valencia ni se hizo nada al respecto? Me puedes hacer un favor. Esque hoy es mi cumple ( 15 años) y me gustaría que me felicitaras. Besos.¡¡ ERES EL MEJOR!! Carmen. Valencia

Object

2631Object24/06/2002 12:35:52

¡Hola David! me gustaría saber cuando vendrás a Barcelona a hacer la firma de discos y también preguntarte por tu canción favorita de tu disco. ¡Gracias por ser como eres! Un beso muy fuerte. Laura(Barcelona)

Object

2632Object24/06/2002 12:35:52

HOLA DAVID!! CREES Q EN ALGUN MOMENTO LA FAMA TE PUEDE PERJUDICAR??¿?BESOS WUAPETON MARIONA (BARCELONA)

Object

2633Object24/06/2002 12:35:53

A los de ELPAIS, ¿en base a qué criterios seleccionáis las preguntas que formular a David Bustamante??. Curiosidad. Saludos.

Object

2634Object24/06/2002 12:35:54

david david ¿es seguro el concierto que haras en IBI -ALICANTE? somos de alcoy y nos gustaria mucho verte en solitario pues ya te vimos con todos tus compañeros en valencia. mari de alcoy.

Object

2635Object24/06/2002 12:36:01

Hola mi vida, ¿Te doleria si yo muriera por ti, por no poder verte?¿Sabes lo que puede llegar a sentir una fan por ti?¿Vas a pasar por Barcelona en la firma de discos?¿Cuando? Te quiero. Raquel Velez.

Object

2636Object24/06/2002 12:36:41

¿Que nos dirias a todas estas fans que quieren morir por ti?Raquel Velez. TE QUIERO

Object

2637Object24/06/2002 12:36:49

Soy Carmen desde Valencia, me gustaria que me contentaras con el conzazon de 20 años, que tienes ¿Tienes algun problema sobre las edades de tus fans?

Object

2638Object24/06/2002 12:36:52

QUERIDO DAVID: COMO DICE UNA DE TUS CANCIONES "POR UN BESO DE TU BOCA YO ME MUERO...". ¿A QUIEN LE CANTARÍAS ESTO?. TE MANDO MILES DE BESOS DESDE TARRAGONA. FELICIDADES POR EL PEDAZO DE DISCO QUE HAS GRABADO!!!! HEIDI

Object

2639Object24/06/2002 12:37:01

¿Cuando será tu firma de discos en Cantabria?Besos _AvAiLaBLe_

Object

2640Object24/06/2002 12:37:27

Hola David. Operación Triunfo es un buen programa, y todos sois gente fantástica, con excelente voz. Pero, ¿no opinas que es injusto que vosotros en 9 meses alcancéis la fama y gente con enorme capacidad para la música y que lleva luchando mucho tiempo no consiga salir a la luz? ¿Cuál es la principal limitación que encuentras en ti mismo para la música?. Muchas gracias, y suerte.

Object

2641Object24/06/2002 12:37:31

david,guapetón ¿realmente eres consciente del gran numero de fans que te siguen?,¿crees que te van a seguir apoyando? como te planteas la vida despues de haber pasado este boom?.una incondicional que te va a seguir apoyando SIEMPRE.UN BESAZO .LIDIA(BARCELONA)

Object

2642Object24/06/2002 12:37:33

DAVID WAPETON, crees q todo este exito q estas teniendo ahora dentro de unos años cuando pase el "boom" de o.t. seguiras triunfando?? yo la verdad creo q si pero a mi me interesa tu opinion...estas preparado para cuando pase el boom y yeguen otros nuevos concursantes??? un beso y un abrazo PAZ ( santander, cerca de tu tierruca) viva san vicente de la barquera!!

Object

2643Object24/06/2002 12:37:43

David,¿La gira compartida entre Tú y Vero cmo va a ser + o-¿¿¡Estoy deseando q llegue el 14 Julio/2 Agosto para disfrutar d esa maravillosa voz,cuerpo..etc.Besos,dulcer y traviesos¡¡Laura(Cordoba)

Object

2644Object24/06/2002 12:37:52

Hola David, la pregunta del millón ... cuantas copias de verdad has vendido de tu disco, un abrazo (Ana)

Object

2645Object24/06/2002 12:37:53

David que piensas de que todas la televisiones y revistas del corazón te quieran sacar novia. Ya sabias que esto iba a pasar pero ¿que piensas sobre ello? Lucia, Madrid

Object

2646Object24/06/2002 12:37:54

Hola David ¿Estas deacuerdo que no hagan otro OT porque si no la prensa y todos, se olvidarian de vosotros? Raquel Velez. Te quiero

Object

2647Object24/06/2002 12:37:54

David, una crítica constructiva, ¿sois conscientes o tú , al menos , de que se os dado muchísima cancha para estar donde estáis? mucha gente con muchos años de trabajo duro no ha llegado a la mitad que vosotros. ¿qué te parece todo esto? Mucha suerte y ánmimo para el duro verano. Alex.

Object

2648Object24/06/2002 12:37:57

!Hola campeon!Mi concursante favorito es Veronica , ¿Que sientes al compartir con ella parte de tu gira?

Object

2649Object24/06/2002 12:37:57

bustamante, es verdad que eres homosexual?? y otra cosa, como puede ser que con lo mal que cantas tuvieras que ganar el tercer puesto que se lo merecia chenoa

Object

2650Object24/06/2002 12:38:06

hola guapeton soy la fan number 1 de murcia y me gustaria saber que dia vas a venir a murcia ala plaza de toros un fuerte beso titin

Object

2651Object24/06/2002 12:38:28

ME LLAMO MARIA Y SOY DE LEON,ME GUSTARIA SABER SI ALGUN DIA PODRÍA TENER LA POSIBILIDAD DE CONOCERTE EN PERSONA.ME GUSTO LO QUE GISELA DIJO DE TI EN UNA OCASION:SI CON LO POCO QUE TE CONOCEMOS LA GENTE DE LA CALLE Y VEMOS LA GRAN HUMANIDAD QUE DESPRENDES..SI TE CONOCIERAMOS PERSONALMENTE..¿COMO NOS QUEDARÍAMOS?ERES ESTUPENDO

Object

2652Object24/06/2002 12:38:29

Hola david soy noelia de oviedo,tengo 6 años,solo decirte que mi madre dice que tengo "bustamantitis",jajaj,y que tengo muchas ganas de verte por aqui,¿Cual seria el sueño mas grande que te gustaria conseguir? un beso

Object

2653Object24/06/2002 12:38:31

!Hola David!Si pudieras cambiar algo de este mundo , ¿Que cambiarias?

Object

2654Object24/06/2002 12:38:32

Hola Busta, me podrias decir ya que nadie lo dice, ¿cuanros discos llevas vendidos? y si eres ya diamante ¿por que no te lo dan?, un saludo caompañero, Florian, Torrelavega

Object

2655Object24/06/2002 12:38:40

hola busta soy una fan tuya,soy susana de valencia quisiera saver si vas a venir a firmar autografos a la piramide de valencia?cuando?

Object

2656Object24/06/2002 12:38:40

Buenas David:¿Cúal es para ti el mejor cantante de todos tus compañeros? ¿Con cúal te llevas peor que lo deseado? Fdo.: Gorka (Eibar)

Object

2657Object24/06/2002 12:38:44

Hola TITIN:Si pudieras cambiar algo en este mundo¿qué cambiarias?¿compartes tu vida con alguien en estos momentos?Muchos besos,tu club de fans TK

Object

2658Object24/06/2002 12:38:45

Hola David ¿Estas de acuerdo que no hagan otro OT porque si no la prensa y todos, se olvidarian de vosotros? Raquel Velez. Te quiero

Object

2659Object24/06/2002 12:38:53

HOLA DAVID!! CUANTOS DISCOS HAS VENDIDO?¿ESQ SE HABLAN D MUCHAS CIFRAS PERO NINGUNA TENGO CONFIRMACION! TE LO MERECES TODO Y MAS! BESOS WUAPETON MARIONA (BARCELONA)

Object

2660Object24/06/2002 12:38:57

Por alguna cosa dejarias de cantar? Un besazo Noelia (paris) tu foro Te kiereee

Object

2661Object24/06/2002 12:38:57

hola wapo ¿que sentiste cuando te nominaron por primera vez? bueno besos guapeton!!! Paz (santander) una cosa mas viva san vicente!!!!!!

Object

2662Object24/06/2002 12:38:58

Seamos claros ¿Cuántas copias llevas vendidas? ¿Por qué no actualizan las cifras o quieren mostrar la realidad? Yo intuyo por donde andas.... Besos DULCES y TRAVIESOS. Te quiero, Isabel

Object

2663Object24/06/2002 12:39:17

Hola Bustamante !! Te acuerdas mucho de tu tierra como nosotros los españoles que vivimos fuera de España nos acordamos de nuestra tierra materna. He escuchado tu CD, ya se vende en el extranjero, y esta muy bien, ademas encuentro la seleccion de las canciones tras su orden, muy especial. No se te ha ocurrido hacer alguna gira, o mejor dicho, alguna actuacion en el extranjero, por ejemplo, Suiza, donde todos hemos seguido tu evolucion desde el primer minuto ?? Un saludo desde Suiza Luis Alberto

Object

2664Object24/06/2002 12:39:24

hola busta soy una chica de 19 años a la q le encanta tu voz y tu disco, es genial yo te preguntaria ¿ crees q la vida te puede deparar algo mejor? ¿que le pides más? eres genial no cambies nunca.Rosa de sevilla.(tus lagrimas son mu lindas q no te quiten tu sentimentalismo)

Object

2665Object24/06/2002 12:39:25

¿en que clase de recintos crees que actuarás dentro de cinco años? en pabellones o en bingos? Maria Jose

Object

2666Object24/06/2002 12:39:32

Hola David.Si tuvieras que definir con una palabra tu vida en estos momentos¿cual utilizarias?Besos TK Nuria

Object

2667Object24/06/2002 12:39:42

david:¿te agrada igual tener admiradores que admiradoras?¿tienes pensado cantar alguna cancion a alguna fan de cada concierto?un besazo,bombon.noemi(valencia)

Object

2668Object24/06/2002 12:39:43

Hola Bustamante.¿Piensas hacer algun concierto en Málaga este verano? ¿y firmar disco?. Un beso. Tengo 12 años y estoy deseando verte de nuevo.

Object

2669Object24/06/2002 12:39:50

Hola David, ¿Cuantas copias de discos llevas ya vendidas? Raquel Velez

Object

2670Object24/06/2002 12:39:53

David:¿Cuales han sido tus mejores momentos?:Dentro o fuera de la academia.Besos Cristina y a ver si te pasas por Valladolid.

Object

2671Object24/06/2002 12:40:01

Explicanos algo sobre tu relacion con tu compañera Gisela. ¿Hay algo especial o no?? Busta hay confianza... Mari. (lih14)

Object

2672Object24/06/2002 12:40:24

que esperas de tu gira? Elena (Madrid)

Object

2673Object24/06/2002 12:40:26

Hola DAvid soy un gran fan tuyo te deseo lo mejor y no te preocupes por las criticas que nosotros tus fans siempre vas a estar ahi.Mi pregunta es:En la gira de Operacion Triunfo ¿Cual a sido tu mejor momento?y en tu gira en solitario¿No te huviese gustado mas ir con Gisela o con Alex?y con esta pregunta no quiere menospreciar a Vero que conste.

Object

2674Object24/06/2002 12:40:28

hola david!he oido q a lo mejor t vas d SAN VICENTE DE LA BARQUERA y te trasladas a barcelona x motivos d trbajo.¿es cierto?¿q vas a hacer sin "tu san vicente de la barquera"?vente a granada mejor q nos tienes muy tristes pk tu gira no pasa x aki.buenoguapeton muchos besos y acuerdate d granada.pilar

Object

2675Object24/06/2002 12:40:40

hola: david que sentiste cuando viste entrar a Cristian por la puerta de la academia?? un besazo guapeton

Object

2676Object24/06/2002 12:40:41

hola busta como estas cuando vas avenir a murcia te espero pronto

Object

2677Object24/06/2002 12:40:44

Hola DAVID!!:¿Te gustaria hacer un concierto en beneficio de alguna ONG?Una chica q te admira mucho.Besitos!

Object

2678Object24/06/2002 12:40:46

¡Hola! Soy Victoria de Barcelona. ¿Cuál es el mejor consejo que te han dado en la Academia?

Object

2679Object24/06/2002 12:40:47

Hola David Crees que sin Operacion Triunfo hubieras llegado algun dia donde estas ahora? Personalmente creo q si, porke tu voz es UNICA Besitos Noelia (Paris)

Object

2680Object24/06/2002 12:40:49

Hola "Ruiseñor del Andamio", soy una gran fan tuya. Tu disco es fantástico, ¿qué hace un artista como tú en su tiempo libre?. ¿Te gustaría escribir tus propias canciones?. Un fuerte abrazo y un besico. Nines (Zaragoza)

Object

2681Object24/06/2002 12:40:52

hola david!!!! soy sandra no se como te lo haces pero eres el mejor!!! la verdad es k si k se como lo haces, cantando asi de bien como cantas, con tu sencillez tu simpatia i tu cariño para toda la gente en especial a tu familia i a tus fans!!!!! todos las del foro estamos impacientes para k te conectes solo falta media hora i los nervios estan a flor de piel!! porfavor dedicanos unas palabras para nosotras k no sabes todo lo k te keremos!!! eres el mejor!!!! ua pregunta como es k no haces ningun concierto en BARCELONA CAPITAL?? tendre k ir a otro sitio mucho mas lejos de barcelona i voy a ir como me llamo sandra! aunke tenga k arrastrar a mi madre por las orejas!! aunke no me costara mucho xq a mi madre le encantas! cuando vendras a firmar discos a barcelona? muchos recuerdos a gisela ya k es mi preferida de las chicas e iba a mi cole las salesianas!!! muchos besossss!!!!! GUAPOOO!!!!! TE KIEROOOOO!!!!! contestame porfavor

Object

2682Object24/06/2002 12:40:53

Hola David, ¿Que sientes cuando ves que millones de personas se saben tus canciones al pie de la letra?Un beso y mucha suerte,Carmen (Malaga).

Object

2683Object24/06/2002 12:40:56

Mi pregunta es la siguiente:¿Que sientes al subirte a un escenario y ver q estás rodeado d miles de personas?Besos,dulces y traviesos.Laura(Córdoba)

Object

2684Object24/06/2002 12:41:01

¿Cuáles son los pros y los contras de la fama y todo lo que existe en torno a ella? Besos dulces y traviesos, chiq16 (La Coruña)

Object

2685Object24/06/2002 12:41:02

Buenas David: Hay rumores de que la fama se te ha subido a la cabeza, ¿sigues siendo como antes? ¿tus amigos te ven igual o te ven como a una estrella? Fdo.: Matutenorio(Eibar)

Object

2686Object24/06/2002 12:41:03

HOLA BUSTA SOY ELISA DE MALLORCA, ¿ CUANDO VIENES A MALLORCA PARA LA FIRMA DE DISCOS?

Object

2687Object24/06/2002 12:41:09

¡Hola David!¿Qué canción es la que más te gusta de tu disco?¿Qué dirias a todas tus fans cuando las ves que estan contigo animandote a seguir así? Un beso muy fuerte y gracias por ser como eres. Nerea (Barcelona)

Object

2688Object24/06/2002 12:41:12

QUERIDO TITÍN: HE OÍDO QUE LOS CHICOS DE OT HABEÍS GRABADO UNA PELÍCULA. ¿QUÉ HAY DE CIERTO EN ESO?. SEGURO QUE COMO ACTOR ERES TAN BUENO QUE COMO CANTANTE. PARA MI SIEMPRE SERÁS EL MEJOR EN TODO. LO MERECES!!! BESOS DE HEIDI (TARRAGONA) AHHH!! FELICIDADES POR EL DISCO, ME ENCANTA!!

Object

2689Object24/06/2002 12:41:23

Hola David, eres mi vida. ¿Sabes lo que una fan puede llegar a sentir por ti? ¿Que nos dirias a todas estas fans que estarian dispuestas a morir por ti? ¿Como te sentirias si te enteraras que una muy fan tuya ha muerto por no poder alcanzar su sueño que en este caso era verte? Te quiero. Raquel Velez Garcia

Object

2690Object24/06/2002 12:41:32

DAVID , CUANDO VAS A IR A LA PIRAMIDE DE EL CORTE INGLES DE VALENCIA??? TE QUIERO MUCHO ME LLAMO CRISTINA Y SOY DE VALENCIA. MI MOVIL:616736460

Object

2691Object24/06/2002 12:41:32

Hola David, ¿qué tal tu faceta compositora? ¿te lanzarás a componer temas? Suerte. INES (Barcelona)

Object

2692Object24/06/2002 12:41:34

Hola David, mirando hacia un futuro, ¿te crees capaz de componer tus propias canciones?Un beso guapeton, de una forera :0) Blanca

Object

2693Object24/06/2002 12:41:42

HOLA DAVID,¿HAS SENTIDO EN ALGUN MOMENTO MIEDO POR UNA AVALANCHA DE FANS INCONTROLADAS?¿LO ENTIENDES?UN BESO.LIDIA(BARCELONA)

Object

2694Object24/06/2002 12:41:54

!Hola David!Si tuvieras que representar a tu pueblo en un Concurso , ¿Que te llevarias de el para enseñar a toda España?

Object

2695Object24/06/2002 12:41:55

David ahora follaras como un loco no??... que se siente sabiendo que tienes mas de 10 millones de tías que te ofrecerian su flor?? Saludos

Object

2696Object24/06/2002 12:42:00

hola busta que podria hacer para conocerte

Object

2697Object24/06/2002 12:42:08

con quien te gustaría hacer un dueto? (a mi no me importaría hacerlo contigo) coralina.

Object

2698Object24/06/2002 12:42:16

hola david: ¿que consejo le darias a todos lo jovenes y no tan jovenes que quieren triunfar en la musica? espero tu respuesta guapeton! besos y abrazos Paz(santander)

Object

2699Object24/06/2002 12:42:56

Hola Busta ¿Donde crees que esta la clave de vender discos, en la calidad o en una buena campaña de marketing?

Object

2700Object24/06/2002 12:43:01

hola busta soy susana de valencia capital soy una mega fan queria saver si vas a venir a firmar a la piramide?a que hora?y si no vas alli donde? adios un beso de tu fan

Object

2701Object24/06/2002 12:43:02

TENGO UNAS GANAS ENORMES DE CONOCER SAN VICENTE DE LA BARQUERA¡¡NO SOLOMENTE PORQUE ES TU TIERRA,SINO PORQUE ME HA CAUTIVADO LO SORPRENDENTEMENTE BELLO QUE SON SON PAISAJES Y SU GENTE,ADEMAS ME HAN DICHO QUE SE COME MUY BIEN ALLI.SERIA MUY GRATO CONOCERTE EN CARNE Y HUESO.MUCHAS GRACIAS.MARIA - LEÓN

Object

2702Object24/06/2002 12:43:13

te sientes un poco agoviado por tus fans? Elena (Madrid9

Object

2703Object24/06/2002 12:43:20

Hola David , ¿sientes que con la fama has perdido tu intimidad?

Object

2704Object24/06/2002 12:43:20

sabemos que te encanta san vicente por que as nacido alli y porque as crecido pero...¿si hubieras nacido en otro lugar pensarias lo mismo?¿bas a volver a instalarte en san vicente de la barquera o iras a barcelona?¡al oeste de cantrabria,siguiendo la carretera hay un...un beso para ti bombon

Object

2705Object24/06/2002 12:43:21

HOLA BUSTA: SOY UNA PAISANA QUE QUIERE FELICITARTE POR TU EXITO Y TU GRAN DISCO.SOY UNA GRANDÌSIMA FANS TUYA Y ME ENCANTAS COMO ERES, ASI QUE SIGUE A SI.EL OTRO DÌA VI LA GALA ESPECIAL QUE TE DEDICARON,Y AUNQUE NO PUDE IR POR NO CONSEGUIR LAS ENTRADAS,YO QUERÌA PREGUNTARTE ¿QUIÈN TE HA ENSEÑADO A BAILAR ASI,PORQUÈ EN LA COREOGRAFÌA DE "EL AIRE QUE ME DAS" BAILAS DE MUERTE Y OTRAS VECES NO TE HABÌA VISTO BAILAR ASI? UN BESAZO.EVUCHI.

Object

2706Object24/06/2002 12:43:29

¿Sabes?Es curioso pero las canciones que mas me gustan de vuestros discos en solitario son los duetos con vuestros compañeros de OT?¿Por que crees que es?

Object

2707Object24/06/2002 12:43:36

Hola David. Q

Object

2708Object24/06/2002 12:43:38

Buenas David: ¿Estás aburrido de que te saquen romances todos los días o por el contrario te parece divertido? Puede que nos veamos el 7 de agosto. Fdo.: Matutenorio (Eibar)

Object

2709Object24/06/2002 12:43:41

hola david¿has sentido alguna vez miedo al fracaso? ¿que es para ti el fracaso? no te preocupes tu ya has triunfado en nuestros corazones, eres una persona muy encantadora y natural(no cambies)besos de rosa de sevilla

Object

2710Object24/06/2002 12:43:45

Hola David soy Ana de Madrid ¿te esperabas el apoyo de tanta gente cuando saliste de la academía y que tu disco tuviese el éxito que ha tenido? No cambies nunca tu foro te quiere. Gracias

Object

2711Object24/06/2002 12:43:46

Dia a dia vas imitando las formas y manera de cantar que bisbal tiene originarias desde un principio,me faltaba por oir que tu cantante favorito es Luis Miguel(lo dijiste en una gala de canal sur),cosa que en 6 meses no te hemos oido decir. Terminaras por ponerte tambien los rizos? Se tu mismo, no necesitas imitar a nadie...(y que conste que me gusta mucho tu voz)

Object

2712Object24/06/2002 12:43:50

¿Qué sientes al subir a un escenario y ver que estás rodeado de miles de fans?Laura(Córdoba)

Object

2713Object24/06/2002 12:43:51

hola busta como va tu relacion con gisela no te lies con ella te lo dice una fan que te quiere es mejor que te lies co vero o geno

Object

2714Object24/06/2002 12:43:53

David,¿ con cual estilo de canción te encuentras más comodo: con las baladas o con las canciones más movidas?. un beso miriam

Object

2715Object24/06/2002 12:43:54

¿Que les dirias a las personas que piensan que imitas mucho a la hora de cantar (la posición inclinada) y las vueltas que das mientras bailas, a David Bisbal? Jose

Object

2716Object24/06/2002 12:43:55

QUERIDO DAVID: SOY HEIDI Y TE ESCRIBO DESDE TARRAGONA. AQUÍ EN CATALUÑA ES TRADICIÓN EN LA NOCHE DE SAN JUAN PEDIR UN DESEO DELANTE DE LA HOGUERA. ¿CÚAL SERÍA EL DESEO QUE PEDIRÍAS TÚ?. BESOS Y GRACIAS POR EL MARAVILLOSO DISCO QUE NOS HAS REGALADO A LAS FANS!!!!!

Object

2717Object24/06/2002 12:44:04

Hola David.Lo primero q te quiero decir es q eres el mejor y q no cambies nunca.¿Como has conseguido q la gente te quiera tanto?Un beso enorme.haber cuando vienes a La Coruña.Many tkm

Object

2718Object24/06/2002 12:44:06

hola busta??????soy una chica q te vio con el pase vip, como te sentirias si vieras un disco tuyo pirata en una de las "MANTAS"??dirias algo???

Object

2719Object24/06/2002 12:44:06

Hola Busta eres el mejor sigue asi, mi pregunta es: ¿Como se puede seguir este chat? gracias enhorabuena por tu cd es el mejor suerte

Object

2720Object24/06/2002 12:44:13

¿Eres consciente que en estos momentos eres (tú y todos los de OP)una máquina de hacer dinero y que el día que esto se acabe, se acabó el apoyo a David Bustamante? Entonces, sólo entonces, se verá quién realmente tiene talento. ¿Estás preparado para ese día?

Object

2721Object24/06/2002 12:44:19

Esto es muy importante para mi, David te importa que te sigan fans que te doblan la edad?

Object

2722Object24/06/2002 12:44:19

David soy de argentina y fanatica de ot, pero desde que comenze a ver el programa sabia que eras una persona especial. te felicito por todo lo que lograste y TE ESPERO POR ARGENTINA-TUCUMAN.¿cuando vienes? elizabeth olea de tucuman-ARGENTINA

Object

2723Object24/06/2002 12:44:19

¿qué es lo que pasa por tu cabeza en esos breves momentos en los que te dejen estar a solas?. ¿puedes decirme cuáles son tus sentimientos al recordar tu vida de hace solo un año y en lo que te has convertido?

Object

2724Object24/06/2002 12:44:23

Busta, cual vida prefieres esta o tu vida de niño en san vicente de la barquera??? Un besazo TQM Noe (Paris)

Object

2725Object24/06/2002 12:44:29

hola busta soy susana de valencia capital soy una mega fan queria saver si vas a venir a firmar a la piramide?a que hora?y si no vas alli donde? adios un beso de tu fan suerte,

Object

2726Object24/06/2002 12:44:38

Hola BUSTAMANTE me gustaria saber ; ¿COMO TE SIENTES DESPUES DE HABER SALIDO DE LA ACADEMIA ? ¿CUAL A SIDO EL MEJOR MOMENTO DE TU VIDA? DENTRO O FUERA DE LA ACADEMIA ESPERO QUE SIGAS TENIENDO TANTO EXITO LAURA Y CRISTINA (VALLADOLID)

Object

2727Object24/06/2002 12:44:45

DAVID, ¿ COMO TE GUSTAN LAS MUJERES?? UN BESO. CRIS ( VALENCIA)

Object

2728Object24/06/2002 12:44:59

Mi pregunta es corta ¿es verdad que respondes a las cartas de todas las fans?un chica loca por tu voz y por ti.deseo que llegue el dia 10 de julio.noemi

Object

2729Object24/06/2002 12:45:11

Hola, ya se que la todos estais contra la pirateria, pero, ¿la gente no compraria mas discos si fueran mas baratos? Hector (madrid)

Object

2730Object24/06/2002 12:45:22

Me encanta que nuevos valores de la calidad de los participantes en Operación Triunfo, tengan un hueco en el panorama musical español. Pero ¿No temeis que sea una nube de verano?

Object

2731Object24/06/2002 12:45:23

Array

Object

2732Object24/06/2002 12:45:27

David, como vas a llevar una gira tan larga. Vas a necesitar muchas vitaminas y mucha miel para la garganta. Cuidate porque te queremos mucho y necesitamos tu prodigiosa garganta por mucho años, guapetón. Lucia

Object

2733Object24/06/2002 12:45:28

Hola David!!! Como te imaginas el concierto de San Vicente el dia 10 de agosto??? Todos estaremos allí contigo. Un beso, Sonia (Millenia).

Object

2734Object24/06/2002 12:45:32

Hola nene¿cómo definirias en pocas palabras estos ultimos 9 meses??Un beso de una adicta al foro, Blanca :o)

Object

2735Object24/06/2002 12:45:47

De tus compañeros de la academia ¿con quien te sentiste mejor a la hora de cantar juntos? J´sé Luis (Valencia)

Object

2736Object24/06/2002 12:45:49

Hola Busta soy un gran admirador tuyo.Mi sueño es llegar donde tu has llegado y quiero decirte que tu disco es el mejor que he escuchado en mi vida y que tu has hecho que cambie de estilo de musica, he pasado del "bacalao" a las baladas y a las canciones melodicas,gracias.Pero mi pregunta es :Que te se paso por el cuerpo cuando tenias en tus manos (por fin) tu sueño (tu propio disco).Muxa suerte y hasta siempre ARTISTAZO.Carlos 15

Object

2737Object24/06/2002 12:46:11

HOLA DAVID!!! UNA DE MIS CANCIONES PREFERIDAS DEL DISCO ES EL DUO QUE CANTAS CON ÁLEX. ¿ALGUNA VEZ TE HA PASADO A TI ESO DE COMPARTIR CHICA CON ALGÚN AMIGO?. BESOS Y ENHORABUENA POR EL PEDAZO DE DISCO QUE HAS SACADO. TE LO MERECES TODO, ERES EL MEJOR!!! HEIDI DE TARRAGONA.

Object

2738Object24/06/2002 12:46:21

DAVID MI PREGUNTA ES ¡si has vendido + de un millón de cópias!!!!!!!!!!!!¿por qué no te han dado el disco de diamantes?porque a parte que te lo mereces!! es que te lo has ganado!! un beso lidia (barcelona)

Object

2739Object24/06/2002 12:46:30

CUANDO SALE A LA VENTA, LAS ENTRADAS PARA EL CONCIERTO DE SANTANDER

Object

2740Object24/06/2002 12:46:33

David:cuando te digeron que irias a eurovision de coro,¿que te paso por la cabeza?un beso muy grande,bombon.noemi(Valencia)

Object

2741Object24/06/2002 12:46:36

Hola David,quisieramos darte desde aquí toda mi familia, nuestra más sincera enhorabuena, por el éxito alcanzado, todos somos seguidores tuyos y somos de todas las edades desde 60 hasta 6 años.Sigue así CAMPEON y no cambies nunca. Un abrazo FAMILIA MILLAN BUITRAGO. Una pregunta ¿recibiste un dibujo de mi sobrinita de 6 años y el Correcaminos de la Warner que te tiramos en el programa de Noche de fiesta (lo recogió Juncal Rivero)?. Me gustaría que me lo confirmases porque la niña no hay día que no me pregunte,ella a ese muñecote le tenía mucho cariño y me lo dió a mí para q te lo entregara. Un beso y espero que me contestes (Vanessa Millán)

Object

2742Object24/06/2002 12:46:42

Buenas Tinín: ¿Creés que los "academicos" de la próxima temporada van a tener el mismo éxito? Un saludo. Fdo.: Matutenorio (Eibar)

Object

2743Object24/06/2002 12:46:47

hola david!!soy carmen de Salamanca y te vi con el pase vip en el concierto que hicisteis aqui, ¿crees que tu vida a cambiado por completo? un beszo. espero que te acuerdes de mi

Object

2744Object24/06/2002 12:46:55

HOLA!! un saludo desde una pamplonica residente en Holanda.. eres el mejor!! oye, sabes si vas a dar algun concierto en pamplona? has estado alguna vez? un beso muy gordo campeon. SONIA

Object

2745Object24/06/2002 12:46:56

BUSTA POR Q NO TE VAS CON GISELA?

Object

2746Object24/06/2002 12:47:02

Buenos días David, tenias previsto hacer un duo con Sergio Dalma que no pudo ser, lo harás más adelante?. Muy bueno tu duo con Fonsi

Object

2747Object24/06/2002 12:47:02

crees que los concursantes de la proxima edicion de OT tendran el mismo exito que vosotros? Elena (Madrid)

Object

2748Object24/06/2002 12:47:04

Hola BUSTA eres el mejor, pero que crees que vieron en ti para que decidieran darte una oportudidad y entrases en el concurso? rakel salamanca

Object

2749Object24/06/2002 12:47:07

Hola, David, soy Susana. ¿Como te sientes en los momentos, supongo que breves, en los que te dejen estar a solas? ¿Cuáles son los sentimientos que pasan entonces por tu cabeza?. Suerte, campeón.

Object

2750Object24/06/2002 12:47:09

David, ¿cual era tu cantante favorito cuando eras pequeño? un beso

Object

2751Object24/06/2002 12:47:13

Buenas Busta,antes de todo felicitarte por tu exito,que eres el mejor y te queremos un monton.Me gustaria saber cuando empieza tu gira en solitario,y si vas a pasa por castilla-la mancha,ya que es la unica comunidad donde no ha llegado la gira,y no me gustaría quedarme sin verte.Te quiero mucho Besikos.No cambies nunca Carmen Lozano 14 años.Albacete

Object

2752Object24/06/2002 12:47:28

que cancion sera tu proximo single?todas son fantasticas asi k no abra ningun problema a la hora de elegirla animo campeon i sigue asi wapo.lidia menorca.

Object

2753Object24/06/2002 12:47:28

hola David,felicidades por el disco que nos has regalado,simplemente genial. Queria preguntarte que es lo que mas añoras de tu vida anterior y que es lo que menos? muchas gracias y un beso muy gordo. sigue asi campeon. Maite (Teulada- Alicante )

Object

2754Object24/06/2002 12:47:29

HOLA!!.¿Has pensado alguna vez q tu destino era ser cantante?¿Que era lo q llevabas en la sangre?Eres el mejor.Besitos!Ana.

Object

2755Object24/06/2002 12:47:34

Hola Busta:Somos 2 chicas de santander y somos tus fans numero 1.Q tal va tu disco?Las dos le tenemos y esta muy chulo. Cuando vas a venir a firmar discos?.Adios wapeton.Sara y lucia(santander)

Object

2756Object24/06/2002 12:47:37

Hola superman!soy tamara de madrid aunque ahora estoy en cantabria.ayer estuve en S.vicente y É INCREÍBLE el apoyo que te demuestran allí¿como les piensas devolver el apoyo?un beso enorme y mira en el bar en el que te conocen porque ahi muchas cosas para ti.NO CAMBIES

Object

2757Object24/06/2002 12:47:54

Hola David!!¿Sentiste decepcion por el 7º puesto?Sé sincero.Gracias.

Object

2758Object24/06/2002 12:47:55

David:Piensas algún día hacer un concierto en Bélgica? Sé que te parece raro,pero si algún día vienes,no te arrepentirás! Te mando un beso enorme desde Bélgica,Manuela(Bruselas)

Object

2759Object24/06/2002 12:48:27

Hola David:¿harás alguna firma de discos?¿cantarás algún duo en tus conciertos?TK Amandita(Nuria)

Object

2760Object24/06/2002 12:48:28

HOLA BUSTA, SOY DE HUELVA Y ME GUSTARIA SABER SI VAS A TENER ALGUN CONCIERTO CERCA DE MI PROVINCIA UNA FANS ENAMORADA

Object

2761Object24/06/2002 12:48:33

David ¿que haras cuando acabes tu gira de verano? ¿te tomaras unas vacaciones? ¿o seguiras tu gira en otros paises? mucha suerte eres el mejor. Raquel (Zaragoza)

Object

2762Object24/06/2002 12:48:40

Buenos días David, tenias previsto hacer un duo con Sergio Dalma que no pudo ser, lo harás más adelante?. Muy bueno tu duo con Fonsi. Teresa. Pinto (Madrid)

Object

2763Object24/06/2002 12:48:44

que esperas de tu gira con Vero? Elena (Madrid)

Object

2764Object24/06/2002 12:48:44

AHORA QUE A ACABADO LA GIRA DE OPERACION TRIUNFO COMO SERA LA RELACION ENTRE VOSOTROS(SOBRE TODO CON ALEX)? ¿ CON QUIEN VAS EN TU GIRA EN SOLITARIO? CRIS(VALENCIA)

Object

2765Object24/06/2002 12:48:46

Hola Busta: Eres el mejor, ya lo sabes. Mi pregunta es la siguiente: ¿De qué profesor de la Academia has absorbido más conocimientos para ponerte ante el público, que aunque te idolatra, también puede llegar a ser muy exigente? Sigue así, Titín!!!

Object

2766Object24/06/2002 12:48:58

Hola David. Antes de nada, felicidades por tu disco. Mi canción favorita es "Duda de amor". Pero, no te pregunto sobre música. He leído que tal vez protagonices 2 películas, una con tus compañeros de O.T y otra que se rodaría en Santander: "Diario de una becaria" de Josetxo San Mateo. Quisiera saber si es cierto. 1 Besazo y sigue así de genial. Tu interpretación de "Perdóname", me llegó al alma. Bea, Cuenca

Object

2767Object24/06/2002 12:48:58

Hola David! soy una de las chicas del foro (si las del pañuelo rojo xD) y queria saber cuando va a ser tu firma de discos en Cantabria Besos _AvAiLaBLe_ (Eva Santander)

Object

2768Object24/06/2002 12:49:12

Hola David... espero que este bien.. ¿ estas contento?... espero que si.. ¿ te molesta de algún modo ese llamado precio de la fama? es decir perder un poco tu privacidad.. Te Quiero.. un beso desde Venezuela... Vanessa

Object

2769Object24/06/2002 12:49:30

david! una curiosidad ¿ te huviese gustado tener una hermana a parte de tus dos hermanos higor y manuel? ANA (CATHYHELL) MALaGA *2gatita

Object

2770Object24/06/2002 12:49:33

Busta:sabemos que tu quieres a las fans pero...que se te pasa por la cabeza cuando las ves llorando y te regalan millones de cosas?un besazo muy grande.bombon.noemi

Object

2771Object24/06/2002 12:49:38

¿Vas a venir a Burgos? Porfi ven Irene río

Object

2772Object24/06/2002 12:49:41

hola guapisimo cunando piensas en el cambio tan grande que ha dado tu vida antes albañil y ahora cantante no es para emocionarte?un besazo d tu fans q desea q llegue el dia 25 d agosto

Object

2773Object24/06/2002 12:49:46

david en menorca te apollamos i kisieramos saber si te pasaras por aqui pq tenemos demasiadas ganas de verte en persona o al menos verte de lejos pero no quedarnos con esa boca abierta de no aberte visto.animo i vente que si es por no pagar en mi casa puedes venir jeje.lidia(menorca)

Object

2774Object24/06/2002 12:49:46

Hola! David, si todo esto no hubiese sucedido, lucgarias por lo que quieres o seguirias trabajando en la obra? Laura, la del Vip(Mallorca)

Object

2775Object24/06/2002 12:49:55

QUERIDO TITÍN: ¿QUÉ SIENTES AHORA QUE YA HA ACABADO LA GIRA CONJUNTA CON LOS COMPAÑEROS DE OT? ¿SI PUDIERAS ELEGIR CÚAL DE ELLOS ELIGIRÍAS PARA TU GIRA EN SOLITARIO? BESOS. HEIDI DE TARRAGONA. QUE SEPAS QUE TU DISCO SUENA EN MI APARATO DE MÚSICA SIN PARAR. ES GENIAL!!!

Object

2776Object24/06/2002 12:49:58

¿Cuales fueron las canciones que mas te gustaron de Eurovision , aparte de la de España?

Object

2777Object24/06/2002 12:49:58

OLA DAVID!!! bueno 1º darte las gracias por venir a PAMPLONA el dia 4! estoy impaciente por verte. Te felicito por tu disco, y queria preguntarte ?como esperas que sea tu gira en solitario? MUCHOS BESOSS . Silvia (Pamplona)

Object

2778Object24/06/2002 12:50:10

Eres muy bueno, para mi el mejor de los 16, pero necesitas seguir formandote musicalmente. Piensas hacerlo. Carmen

Object

2779Object24/06/2002 12:50:12

David ¿por que no vienes a malaga un domingo?.( se que la respuesta es tonta) pero es que yo trabajo el resto de la semana por la tarde y no puedo ir a tus conciertos....Y llevo esperandolos muchooooooooooooo tiempoooooooooooo. en fin ¿ que esperas de la gira?. Un besote mu mu grande susana (suropa)

Object

2780Object24/06/2002 12:50:13

Hola Busta. ¿Vas a hacer un concierto en Tenerife? Para mi eres el mejor

Object

2781Object24/06/2002 12:50:15

¿Piensas que con el tiempo tú y tus compañeros de OT perdereis el contacto con el tiempo o seguireis siendo amigos siempre?

Object

2782Object24/06/2002 12:50:19

¿Cuáles son los pros y los contras de la fama y todo lo que existe en torno a ella? Besos, chiq16 (La Coruña)

Object

2783Object24/06/2002 12:50:20

hola david, queria darte lo primero la enhorabuena por tu cd es muy bueno y tb preguntarte que es lo k se siente de ser una persona normal y corriente a ser el idolo tanta gente.un beso.lolika

Object

2784Object24/06/2002 12:50:20

Hola David, ¿Vas a pasar por Barcelona en la FIRMA DE DISCOS? Mandame un beso. Raquel Velez

Object

2785Object24/06/2002 12:50:21

Buenas David: ¿cual de tus compañeros crees que tiene asegurada una carrera musical?. Fdo.: Matutenorio (Eibar)

Object

2786Object24/06/2002 12:50:22

¿estas contento con los resultados q has obtenido tras tu paso por OT? ¿esperabas este exito? Azahara y MªLuisa (MURCIA)

Object

2787Object24/06/2002 12:50:25

BUENAS BUSTA!ME GUSTARIA SABER SI AHORA QUE ERES TAN FAMOSO HECHAS DE MENOS TU VIDA ANTERIOR.PODER PASEAR POR LA CALLE TRANQUILAMENTE,SIN QUE SIEMPRE HAYA ALGUIEN DETRAS TUYO...aunque todo sea muy bonito tienes que hechar esas cosas de menos ¿no?uUN BESO(africa valencia)

Object

2788Object24/06/2002 12:50:29

Hola Busta , imaginate que no hubiera salido ot , de tus compañeros ,¿quien crees que habria tenido exito? no digas (no los se) di alguno , yo creo que (ademas de ti) Alejandro , saludos ljga (valencia).

Object

2789Object24/06/2002 12:50:30

Hola Bustamante! Te quiero preguntar cual de tus cansiones es tu favorita? Yo vivo en Suecia y si puedes contestar a esta otra pregunta seria muy feliz, Has pensado viajar a otros paises de Europa?? Eres el mejor!!! Un beso super grande!! -Susan

Object

2790Object24/06/2002 12:50:32

Hola David! cuando cantabas tus canciones, en que persona te inspirabas? como por ejemplo en la cancion cuando hacemos el amor? 1 besote muy grande, de tu fan number 1. Marta (mollerussa)

Object

2791Object24/06/2002 12:50:32

Hola David. Hace ya un tiempo que cambiaron tu forma de vestir, así como un poco el peinado. Dejando de lado lo que digan o no tus estilistas, te gusta la imagen que tienes ahora, o la que tenías antes, más juvenil y apropiada para un chico de tu edad? Te deseo lo mejor, Besos, Yuna.

Object

2792Object24/06/2002 12:50:35

Hola, ¿tienes alguna idea de cual va a ser tu segundo single? A mi me gusta mucho la cancion de No soy un superman, es buenisima. Un saludo

Object

2793Object24/06/2002 12:50:37

Hola Busta eres un chico corriente,eres un chico normal,pero no se lo tienes que no te puedo olvidar.Mis preguntas son¿Yo soy de Tenerife y me gustaria saber q tal te parecio la isla?Y la otra q x q no vienes aki de gira o a firmar los discos con las ganas q tenia de q vinieras?Nada mas y q sepas q eres el MEJOR!!!Y q siempre lo sera wapeton no cambies!!!Un fuerte abrazo y un besazo de tu fan 1º Melisa.Besos wapo!!!

Object

2794Object24/06/2002 12:50:44

Hola David Bustamante. ¿Cuál ha sido tu mejor experiencia dentro de la Academia?, y ¿la peor?. Un abrazo y suerte. Nines (Zaragoza)

Object

2795Object24/06/2002 12:50:58

Hola Titin soy Yolanda (BCN) y me gustaria saber si vas a hacer algún concierto antes del mes de julio. Deseando que tengas la mayor de las suertes con este pedazo de disco que nos has dado, y beso muy grande de una de tantas fans que tienes.

Object

2796Object24/06/2002 12:51:01

¿Que cancion es tu favorita del disco?Raquel Velez

Object

2797Object24/06/2002 12:51:03

se sabe que tu eres el mejor pero¿que piensas cuando no te dejan de decir que eres demasiado sensible?un beso.noemi

Object

2798Object24/06/2002 12:51:19

¿Cual es tu numero favorito?Raquel Velez

Object

2799Object24/06/2002 12:51:23

Hola David. ¿Como te sientes al haber realizado este cambio de vida tan radical? ¿Ha sido facil? ¿Que es lo que mas extrañas de la academia? Isabel

Object

2800Object24/06/2002 12:51:37

Hola David! Es verdad que mañana grabas el videoclip de tu nuevo single en la Costa Brava? Si es así probaré suerte e iré a verte! Mucha suerte en la gira!!! Y siempre pa'lante!!! Malia Barcelona.

Object

2801Object24/06/2002 12:51:43

hola busta me llamo belen d sevilla y me gustaria preguntart si vas a venir a firmar discos a sevilla por favor,es muy important y tienes q venir x favor!!!un besito

Object

2802Object24/06/2002 12:51:44

Estimado David, Mi más sincera enhorabuena porque creo que has sido un merecedor finalista del concurso y porque, en mi opinión, eres la persona que más ha evolucionado dentro de la academia. Mi pregunta es: ¿cuáles de las distintas cualidades que debe tener un buen intérprete crees que todavía necesitas pulir más?. Muchas gracias y enhorabuena por tu éxito.

Object

2803Object24/06/2002 12:51:50

hola david¿cual de las canciones q cantaste en las galas fue la que mas te gustó y porque? una cosa puedes felicitarmes esq hoy es mi cumple. besos. carmen (valencia)

Object

2804Object24/06/2002 12:51:51

DAVID:¿Piensas q O.T es lo mejor que te ha podido pasar en la vida?De una admiradora secreta.Jajaja.BESITOS!

Object

2805Object24/06/2002 12:51:51

Porqué eres tan gay y das tanto asco y no sabes cantar y eres tan feo de cara y tan cuñao y te crees tanto y vas kemao obrerucho de mierda q das pena q tienes mas piojos q la sonia Y ERES UN FLIPAO!!!LLORICA!! VAS A PONERTE A LLORAR??? cuidao! PUTAS NIÑATAS LAS Q TE VOTAN SI NO SABES CANTAR!!!

Object

2806Object24/06/2002 12:51:52

hola bustamante!!! Que soñabas de ser de grande, cuando apenas tenias 12 años? muchos besos!!! adios.

Object

2807Object24/06/2002 12:51:54

Soys novios tu y Gisela? Me gusta mucho coma cantas Unbeso

Object

2808Object24/06/2002 12:51:58

Hola David, eres mi vida. ¿Sabes lo que una fan puede llegar a sentir por ti? ¿Que nos dirias a todas estas fans que estarian dispuestas a morir por ti? ¿Como te sentirias si te enteraras que una muy fan tuya ha muerto por no poder alcanzar su sueño que en este caso era verte? Te quiero. Raquel Velez Garcia.ENVIAME UN BESO

Object

2809Object24/06/2002 12:52:02

hola guapeton.me gustaria preguntarte si tus hermanos tambien saben cantar.mi otra pregunta es,¿pk tu gira no pasa x granada?es una pena,ademas aki s te quiere muchisimo.muchos besos,pilar(granada)

Object

2810Object24/06/2002 12:52:07

david ¿que piensas del tema gisela bustamante? ANA (CATHYHELL) MALAGA *2gatita

Object

2811Object24/06/2002 12:52:12

hola david,¿como te sientes al ver a todas esas niñas esperandote a las salidas de los programas ,del aeropuerto, de la casa? cuando vendras a barcelona a firmar discos? sandra muchos besos!

Object

2812Object24/06/2002 12:52:19

David, antes que nada felicitarte por tu maravilloso trabajo. Mi pregunta es sobre tu increible voz. ¿Estás haciendo algo especial para cuidártela? Con el ritmo de trabajo que vas a tener ¿sigues alguna indicación de especialistas, ejercicios o lo que sea, para no perjudicar tu garganta? Y por favor deja de fumar, un consejo de una máquina de echar humo como yo, que quiere seguir disfrutando de tu voz muchos años. Besos, Luci (Bilbao)

Object

2813Object24/06/2002 12:52:21

Hola Busta!Qué tal llevas el estar lejos de tu familia y de tu tierra?Y qué tal llevan ellos tu éxito?.Espero que sigas viniendo por aquí aunque ahora tengas que vivir fuera.Un beso.Pilar.Torrelavega. Tu actuación en Santander, impresionante.

Object

2814Object24/06/2002 12:52:24

¿que se te pasa por la cabeza cuando ves a todas tus fans locas por acercarse a ti?noemi,un beso

Object

2815Object24/06/2002 12:52:35

¿Qué les dirías a la gente que lleva muchos años intentando hacerse un hueco en el panorama musical y todavía no lo ha conseguido? Fdo.: Matutenorio (Eibar)

Object

2816Object24/06/2002 12:52:35

Hola David soy Dora de Pedreguer en ALICANTE como te sientes despues de haver pasado de obrero hasta el mejor cantante de O.T.? Crees que es justo que haya mucha gente intentando salir a la luz con sus temas y estrenarse y no lo pueden conseguir y que vosotros en 3 meses hayays sido populares. mi nº es el 669307592 llamame.

Object

2817Object24/06/2002 12:52:35

colega, me da igual q digan q lloravas y tal tal, te merecias ganar por tu esfuerzo,¿crees q gisela esta buena o es solo mi vista?

Object

2818Object24/06/2002 12:52:47

HOLA BUSTA: ERES EL MEJOR, ESPERO QUE NO CAMBIES NUNCA. ¿ECHAS DE MENOS TU ANTIGUA VIDA? ¿TE HA COSTADO ADAPTARTE A LA NUEVA? UN ABRAZO MUY FUERTE. KEKA(VALLADOLID)

Object

2819Object24/06/2002 12:52:53

hola bustaaaaaaaaaaaaaaaaa!!yo no te escribo pa harcerte ninguna pregunta..me conformo con que le mandes un saludo a una amiga que esta un poco depre..se llama belen pedraza gracias wapeton!!NaiaDe^

Object

2820Object24/06/2002 12:53:03

Yo soy actor, aficionado, pues las oportunidades son muy escasas y muy a menudo con nombre. Y he disfrutado con OT, y además he sentido mucha envidia, eso si, sana y además me alegro por lo que estais consiguiendo. Pero, el problema le veo, en que se os suba a la cabeza y empeceis a mirar por encima del hombro, y por supuesto a vender exclusivas, que den dinero fácil. ¿Te sientes con la suficiente personalidad, como para saber de donde has partido y que el que hoy pierde "amigos" (los de diario y los que te hemos encumbrado con la compra de discos), por su orgullo, mañana pueden cerrarle las puertas? Un saludo y suerte. Angel (Getafe)

Object

2821Object24/06/2002 12:53:06

Enhorabuena David, por tu trabajo y tu éxito alcanzado.Mi pregunta es la siguiente ¿ os lleváis todos tan bien como parece? Pienso que es muy díficil que no haya surgido ningún problema entre 16 personas, aunque sea mínimo. ¿Tienes el Coyote de la Warner que te tiramos en Noche de fiesta? Necesito que me lo confirmes. Un abrazo Vanessa Millán (Arganda del Rey.-Madrid)

Object

2822Object24/06/2002 12:53:07

hola david, cual es la cancion que mas te gusta de tu cd?? a mi todas pero en especial la de no soy un superman. bueno un besiko. LOLA (Murcia)

Object

2823Object24/06/2002 12:53:07

hola david: crees que fue justo vuestro puesto en EUROVISION??? besazos guapeton!

Object

2824Object24/06/2002 12:53:10

cual es la cancion que te a gustado mas cantarla en la academia?

Object

2825Object24/06/2002 12:53:10

Bustamante, sinceramente si tendrías que dar un disco de platino o alguno de diamante a alguno de tus compañeros a quien te haria mas ilusión entregarlo! Dime un nombre por favor, gracias! Espero que recibas tu disco de diamante pronto! Suerte.

Object

2826Object24/06/2002 12:53:22

hola david! crees q fue justo q ganara quin gano en eurovision?¿ besos mariona (bcn)

Object

2827Object24/06/2002 12:53:23

¿CREES QUE MO SERAS UN ADOLESCENTE PRECOZ DEBIDO A TU FAMA? TE CONOCI CON SARDA EN BARCELONA, EN LUZ DE GAS, CREO QUE ERES UN TIO MAJO, PERO CUIDATE. UN ABRAZO CANDIDO

Object

2828Object24/06/2002 12:53:23

Hola guapo!soy una chica de Zaragoza me llamo Maria. Me gustaria saber que opinas que un cantante nace o se hace.Un besazo y animo

Object

2829Object24/06/2002 12:53:26

Bustamante, soy una superfan Nº1 tuya, te quiero con locura y estoy segura que incluyendo mi vida, daria todo pot ti, todo!!!! Diciendote esto solo tienes quq pensar un poco para saber todo lo que te quiero, no??? Bueno, pues la verdad es que estoy destrozada porque en tu gira de verano, pasas por un monton de sitios pero hay uno que se os ha olvidado, es San Sebastian, en Guipuzkoa, no se porque pero por aqui no pasais. Porque no??? B

Object

2830Object24/06/2002 12:53:27

hola david de los discos de tus compañeros de OT ¿Con que cancion te kedarias? ANA MALAGA *2gatita CATHYHELL

Object

2831Object24/06/2002 12:53:29

¿Es verdad que tienes proyectos de cine?¿Piensas llevarlo como una carrera alternativa a la música?Chiqui

Object

2832Object24/06/2002 12:53:32

hola don David Bustamante ¿crees que algun dia conseguiras el disco de diamante? por que yo creeo que si ¿y tu bombon?. Mª Jose de Caudete Albacete.

Object

2833Object24/06/2002 12:53:32

David: ¿Que harías si tu disco no fuese como va en las ventas?Pablo, un abrazo

Object

2834Object24/06/2002 12:53:39

Hola encanto, tienes una voz preciosa y me gustaria saber bajo tu punto de vista con cual de tus compañeros se acopla mejor tu voz para hacer un duo. A mi me gustaria escucharte con Rosa. Teresa. Pinto (Madrid)

Object

2835Object24/06/2002 12:53:46

hola Busta.¿Es verdad que vas a hacer la gira con Veronica?Besos de una fan tuya de Málaga.

Object

2836Object24/06/2002 12:53:49

DAvid, ante todo GRACIAS por ser tan buen representante de la provincia de Cantabria. Eres un orgullo para todos nosotros. ¿Como piensas que va a acabar toda esta espiral en la que estás afortunadamente, por ahora, enganchado? Miles de besos. Rebeca

Object

2837Object24/06/2002 12:53:55

Hola Busta, tienes una magia especial en tu voz, y con ella has enamorado a un montón de personas.¿Hace un año te imaginabas que ibas a estar donde estás ahora?Sigue así guapetón, no cambies.María(Granada)

Object

2838Object24/06/2002 12:53:55

Hola Busta, eres el mejor, eres muy grande. ¿Piensas que esta fama se va a acabar algún día? Si es así, seguirás luchando por la música o pensarás en otras cosas y te retirarás? SILVIA

Object

2839Object24/06/2002 12:54:01

Hola Bustamante.¿Crees que operacion triunfo te a abierto las puertas para cumplir tu sueño? Eres el mejor, sigue asi de simpático. Elisa (Mallorca)

Object

2840Object24/06/2002 12:54:04

David.. te queremos por América.. eres sencillamente genial wapo.. ¿piensas visitarnos pronto?.. un beso desde Venezuela... Vanessa

Object

2841Object24/06/2002 12:54:10

David,desde que existe O.T parece que ese el el único camino para que una persona normal de la calle como nosotros,realice el sueño de poder ser cantante.Tú que ahora estas en ese mundillo ¿qué otros caminos existen para llegar? hay muchas personas q no han podido presentarse a O.T pero quieren seguir luchando por su sueño.Besucos paisanu.Elenuca (Cantabria)

Object

2842Object24/06/2002 12:54:14

hola david.lo primero enhorabuena por todo lo que has conseguido!lo segundo no crees q son un poco injustos contigo algunas veces?no te sacan tanto como a otros sabiendo que eres el que mas gusta?un beso para mi desde luego eres el numero 1

Object

2843Object24/06/2002 12:54:14

¿Estáis preparados para ver como cuando empiece OT-2 y necesiten promocionar a los nuevos "productos" os dejen de lado para no entorpecer las nuevas ventas?

Object

2844Object24/06/2002 12:54:17

Hola David, eres mi vida. ¿Sabes lo que una fan puede llegar a sentir por ti? ¿Que nos dirias a todas estas fans que estarian dispuestas a morir por ti? ¿Como te sentirias si te enteraras que una muy fan tuya ha muerto por no poder alcanzar su sueño que en este caso era verte? Te quiero. Raquel Velez Garcia.ENVIAME UN BESO.

Object

2845Object24/06/2002 12:54:23

Hola David, soy Noemí de Mataró (BCN) y me gustaría saber más cosas de la película que vais a hacer todos los triunfitos este verano. También querría saber si es verdad que tú también vas a hacer una peli en la que harás de becario. Suerte, eres el mejor.

Object

2846Object24/06/2002 12:54:26

QUERIDO DAVID: ¿CÓMO SE LLEVA ESO DE ESTAR TANTO TIEMPO LEJOS DE LA FAMILIA Y DE LOS AMIGOS?. BESOS DE HEIDI (TARRAGONA). MILES DE GRACIAS POR ESTE DISCO TAN BONITO QUE NOS HAS REGALADO. SEGURO QUE LLEGARÁS AÚN MÁS LEJOS. TÚ LO MERECES. SUERTE!!!

Object

2847Object24/06/2002 12:54:30

Que tal la sesion de depilacion???

Object

2848Object24/06/2002 12:54:34

hola david¿ q sentiste cuando te dijeron q harias los coros a rosa? te lo esperabas?¿ besos wuapo! mariona(barcelona)

Object

2849Object24/06/2002 12:54:35

bustamante guapo tu vienes a cadiz a firmar discos

Object

2850Object24/06/2002 12:54:42

Ya David, por siempre estás con todos nosotros. Pero si tú, que me lees, sientes correr algo de inspiración musical por tus venas, disfruta haciendo tu trabajo. Porque quiero forma parte SIEMPRE de tu obra, David.

Object

2851Object24/06/2002 12:54:51

¿Crees que si erés un luchador/a al final consigues tu sueños?un beso.noemi

Object

2852Object24/06/2002 12:54:52

Ya David, por siempre estás con la Humanidad. Pero si tú, que me lees, sientes correr algo de inspiración musical por tus venas, disfruta haciendo tu trabajo. Porque quiero forma parte SIEMPRE de tu obra, David.

Object

2853Object24/06/2002 12:54:54

Hola David,¿nunca pensaste en poder formar un duo con alguno de tus compañeros de la academia?,Gracias,Salva

Object

2854Object24/06/2002 12:55:02

Hola guapeton!!! ¿Que sientes al ver que tienes tantos fans, incluso que hacen noche y horas de cola para estar cerca de ti cuando cantas??? un beso dulce y travieso!! Clara (Valencia)

Object

2855Object24/06/2002 12:55:03

colega, me da igual q digan q lloravas y tal tal, te merecias ganar por tu esfuerzo,¿crees q gisela esta buena o es solo mi vista?joikot (torrent, valecia,vixcavalencia).

Object

2856Object24/06/2002 12:55:18

que le dirias a toda la gente que le gustaria llegar donde tu has llegado? jose

Object

2857Object24/06/2002 12:55:19

PORQUE ERES TAN ASKEROSAMENTE TONTO Y CREIDO? COMO PUEDE SER QUE CANTES TAN MAL Y TNGAS EXITO? NO TE DAS CUENTA QUE MATAS DOS PAJAROS DE UN GALLO? PORQUE HAS DE HACER COMO QUE ERES GAY PA TENER EXITO? AH QUE NO ESTABAS HACIENDOLO APOSTA? POS LO DISIMULAS MUY BIEN! Y A LAS NIÑATAS HIJASDEPUTA QUE LO VOTAN YA NOS VEREMOS JURO QUE COMO VEA UNA CON LA CAMISETA CON LA CARA DEL BUSCAAMANTE LE PARTO LA CEBEZA

Object

2858Object24/06/2002 12:55:25

Hola David! Eres el mejor, aunque tú ya lo sabes. Tus actuaciones en la Academia me encantaron, sobre todo la de "Perdóname" y "Amantes de ocasión", la que menos fue la de "Azul", tal vez fue porque estoy acostumbrada a oírla de boca de Cristian, peazo voz. Mi pregunta es, ¿qué sientes cuando la gente opina de tí sin conocerte? Lo digo porque yo he tenido que luchar a viento y marea con mis compis de piso para que se callasen unas cuantas cosejas sobre tí. 1 Besazo muy grande, sigue así eres el mejor. Bea.

Object

2859Object24/06/2002 12:55:27

Hola Busta me llamo Irene y tengo 9 años y mi pregunta es ¿que canción te gustaba antes de sacar el disco? y ¿por que?

Object

2860Object24/06/2002 12:55:32

Bustamante, soy una superfan Nº1 tuya, te quiero con locura y estoy segura que incluyendo mi vida, daria todo pot ti, todo!!!! Diciendote esto solo tienes quq pensar un poco para saber todo lo que te quiero, no??? Bueno, pues la verdad es que estoy destrozada porque en tu gira de verano pasas por un monton de sitios pero hay uno que se os ha olvidado, es San Sebastian, en Guipuzkoa, no se porque pero por aqui no pasais. Porque no??? Bueno mi chico te quiero con locura y que sepas que aqui en Donosti tambien te queremos mucho, vale??? TE QUIERO. MARINA, 13.

Object

2861Object24/06/2002 12:55:33

Ahora que tienes tanto trabajo ¿como ves eso de conocer a chicas, salir de discoteca y todo lo que hacemos los jovenes?Lo tienes que tener un poco dificil ¿No? ---LeriLaura--

Object

2862Object24/06/2002 12:55:37

Mi pregunta David esla de todas tus fans, noa gustarias nos explicases tú si lo sabes..como se confecciona la lista de los 40, pues todas las semanas eres uno de los más votados y no te incluyen en la lista. otra pregunta explica los discos vendidos y que suministren a las tiendas pues hay establecimientos que estan agotados.Un abrazo de una fans madurita. Marisa(toledo)

Object

2863Object24/06/2002 12:55:45

David que opinion te merece que tu con 20 años tengas fans que te superen en 15 años la edad?

Object

2864Object24/06/2002 12:55:46

TTTTTTTTTTTEEEEEEEEEEEE QQQQQQQQUUUUUIEEEEEEEEEERO

Object

2865Object24/06/2002 12:55:59

Bustamante.¿quien esta en tu corazon ¨ademas de ti¨?

Object

2866Object24/06/2002 12:56:09

hola Busta!! ¿qué le dirías a toda esa gente que decide comprarse los discos piratas o se bajan la mñúsica de internet?

Object

2867Object24/06/2002 12:56:13

Pero a ti te parece normal que hayas llegado a esa cima a base de sentimentalismos impuros y tener un cuerpazo?Pq tu voz no llega a mas. y no es ni mejor que la de Juan.

Object

2868Object24/06/2002 12:56:17

¿Crees que los 16 tendreis sitio dentro del panorama de música español?. Si la respuesta es afirmativa. ¿Por qué vais a hacer conciertos Verónica y tú, Chenoa y Bisbal?. >Personalmente, algunos se quedarán por el camino aunque no se lo merezcan.

Object

2869Object24/06/2002 12:56:17

que piensas hacer despues de la gira?

Object

2870Object24/06/2002 12:56:18

Hola David, en la academia ya te admiraba por como eras, pero desde que has salido nos has demostrado el peazo artista que estas echo. Cada vez que escucho tu disco me enamoro más de ti, y de esa grandísima voz que Dios te ha dado. Un beso de Lorena de Motilla del Palancar (Cuenca), que te quiere muchíisimo y que siempre estaré ahí apoyándote. Ánimo y adelante que tienes mucho futuro. DAVID BUSTAMANTE DISCO DE DIAMANTE. Besos

Object

2871Object24/06/2002 12:56:18

david ¿cual es tu grupo favorito?.mi familia es cantabra y san vicente es precioso.por cierto el 6 de setiembre actuas con vero en ponferrada,te esperamos con los brazos abiertos .carolina,ponferrada,leon.

Object

2872Object24/06/2002 12:56:22

¿Es verdad que cada vez que ves un andamio sientes nostalgia?un beso muy grande.noemi

Object

2873Object24/06/2002 12:56:28

Mucha gente piensa que, además de tu carrera musical, tienes por delante una carrera cinematográfica. ¿Te han ofrecido ya algún trabajo en el cine? Si te lo ofrecieran, lo aceptarías? Guisando (de tu foro de Portalmix)

Object

2874Object24/06/2002 12:56:29

Hola Busta quería saber si vas a venir a firmar discos a Tenerife(por favor) ya que no vienes a dar un concierto, hazlo por tu fan.Marta(Tenerife)

Object

2875Object24/06/2002 12:56:34

Hola Bustamante!! Mi pregunta es: Cual es tu cansion favorita de tu disco? Yo vivo en Suecia y me pongo super contenta si es que me respondes esta otra pregunta: Has pensado viejar ha otros paises de Europa? Eres el mejor y buena suerte en el futuro! Un beso super grande -susan

Object

2876Object24/06/2002 12:56:42

A ver si poneis todas las preguntas. no solo las que interesen a nivel comercial pues creo que ya habeis omitido las que no os interesan, demostrando que en realidad todo esto es un autentico montaje.

Object

2877Object24/06/2002 12:56:51

Lloraste mucho con la eliinación de España?

Object

2878Object24/06/2002 12:56:56

Hola!BUSTAMANTE,felicidades por tu gran disco.¿Que sientes al saber que ahora vas a hacer una gira en solitario? UN BESAZO DE TU FAN Nº 1. Silvia (pamplona)

Object

2879Object24/06/2002 12:56:57

hola bustamante guapo tu vienes a cadiz a firmar discos a cadiz y tu tienes internet por favor dame tu nick

Object

2880Object24/06/2002 12:56:57

David, tengo una dudilla y me gustaría que me la contestaras, en tu gira no aparece Granada, ¿no vas a pasar por la tierra de Rosa?Anda apañao pasa por Granada, que hay un montón de granadinas con unas ganas enormes de verte.Besos

Object

2881Object24/06/2002 12:56:57

HOLA MI NIÑO,ME ENCANTA TU DISCO, LAS FOTOS SON GENIALES.¿PIENSAS VENIR A PUCELA?MUCHOS BESOS. ERES EL MEJOR.REBECA

Object

2882Object24/06/2002 12:57:00

Hola David, soy Maria de Murcia, quisiera saber si te sientes cómodo bailando tus canciones ràpidas por ejemplo la de el aire que me das, que sepas que para mí bailas de maravilla sigue asi suerte

Object

2883Object24/06/2002 12:57:00

Hola David enhorabuena por todo lo que te esta pasando te lo mereces.¿Que relación tienes ahora con tus compañeros de O T? Mucha suerte. Raquel

Object

2884Object24/06/2002 12:57:06

Hola guapisimo!vas hacer una firma de discos y si es asi, vendras a Barcelona?cuando? un besazo de Maribel

Object

2885Object24/06/2002 12:57:07

HOLA BUSTA ¿VASA VENIR A BURGOS? QUE TENGAS MUCHO EXITO YO TE APOYARE HASTA EL FIN .UN BESO MUY GRANDE ,DE IRENE ,BURGOS

Object

2886Object24/06/2002 12:57:09

david: ¿que fue lo que pensate cuando viste el anuncio de operacion triunfo?¿creiste que ivas a llegar a sonde estas? henorabuena tu disco es fantastico. Rocio (cordoba)

Object

2887Object24/06/2002 12:57:10

HOla David, cuando te nombradoron ganador, que sentiste? I cuando te dijeron que ibas a eurovision? Espero que me contestes. 1 besote david! Marta (mollerussa)

Object

2888Object24/06/2002 12:57:21

david ¿que margen de tiempo tendreis de concierto a concierto en la gira que realizaras con vero?un basazo.lidia(barcelona)

Object

2889Object24/06/2002 12:57:22

hola, busta.me gustaria saber que ha supuesto para ti el paso por la academia, si te te ha echo madurar o si sigues igual que siempre?

Object

2890Object24/06/2002 12:57:24

Hola! Eres uno de los tres finalistas y además de los pocos con 5 discos de platino. ¿Crees que los que pasásteis por OT os mantendréis definitivamente como cantantes o ha sido simplemente un programa de éxito durante este año? Suerte.

Object

2891Object24/06/2002 12:57:29

COMO YEVAS ESTO DE LA FAMA?

Object

2892Object24/06/2002 12:57:30

Me llamo Patricia y soy de La Coruña.Cual va a ser tu proximo single del disco??Decirte que eres de lo mejorcito como artista y como persona.No cambies nunca.Y felicitarte por tu disco que cuando lo empiezas a escuchar no lo puedes dejar.Un besazo de una gallega que te quiere mucho y te admira.

Object

2893Object24/06/2002 12:57:32

Si el alex t pidiese rollo a la vez q el juan y el alejandro t pidiese petada a kien dirias q si? a los tres no puto gay?o t mola el bisbal?

Object

2894Object24/06/2002 12:57:39

hola david!! cuando te vas a ir d promocion por latinoamerica? besos mariona (bcn)

Object

2895Object24/06/2002 12:57:42

¿Que canción de tu disco pondrías candidata para ser cancion del verano? Pablo de Madrid

Object

2896Object24/06/2002 12:57:48

Hola wapeton! que tal llevas esto de la fama? te estas acostumbrando o todavia no te lo crees?? Muchos besos y responde por favor. SANDRA

Object

2897Object24/06/2002 12:57:51

Hola mi Lindo y Talentoso Bustamante te escribo desde la Rep.Dominicana,Pues mira mi sueño es poder llegar a donde tu estas en la musica y tamb me encantaria participar en O.T de españa ya hay en varios paises pero yo quiero ir al de españa ¿Que le aconsejarias a personas como yo que tenemos el sueño de triunfar en la musica, que paso crees tu que las personas como yo deberiamos de dar? ATT:Ivanova Rodriguez y Leidy Ruiz.

Object

2898Object24/06/2002 12:57:54

¿Que es lo malo de ser una estrella de la musica como tu?espero llegar un dia donde estas tu,un beso.Noemi.(Valencia)

Object

2899Object24/06/2002 12:58:02

Hola! Me encanta tu disco, está muy guapo y me gustaría saber si piensas hacer un lanzamiento internacional con él. También me podrías decir si en el próximo disco vas a incluir alguna canción en inglés. Merci.

Object

2900Object24/06/2002 12:58:03

Hola David.Me gustaria saber que canción te gustaria que fuera el nuevo single. Judit, muchos besos wapeton.

Object

2901Object24/06/2002 12:58:05

Hola David Muy buenos días queria preguntarte que aprecias más en una mujer: su belleza interior o su belleza exterior. Muchos Besos Vane de MÁLAGA ¡¡¡¡¡¡¡¡¡¡ ADELANTE TRIUNFADOR !!!!!!!!!!!!!!!!

Object

2902Object24/06/2002 12:58:06

hola busta q tal hay algo entrr gisela y tu??? amigos no?? eso esta bien un beso dame tu numero de telefono o tu direccion.paloma

Object

2903Object24/06/2002 12:58:16

Hola David. Supongo que echarás de menos los platos que tu madre te hacía cuando estás fuera de casa, ¿qué es lo que sueles comer en la gira? ¿Comida rápida o algo más elaborado?

Object

2904Object24/06/2002 12:58:27

marta de malaga antes de nada suerte en tu nuevo disco. cuando sacaste tu disco a la venta pensabas q hibas ha vender tanto en tan pocos dias????

Object

2905Object24/06/2002 12:58:29

Bustamante, ¿que tal? espero te encuentres bien. ¿Para cuando tienes planeado venir a America? te estamos esperando! Saludos a los triunfitos, ¡son los mejores!. Daniel (USA)

Object

2906Object24/06/2002 12:58:36

hola busta,soy jenni de bilbo.me gustaria saber porque no haces conciertos en el pais vasco por que se te quiere muchisimo.solo decirte que no te olvidare,por que has sembrado tanto amor que¿como no quererte?seria imposible.musus.

Object

2907Object24/06/2002 12:58:37

¿por qué elegiste "ademas de ti" que es una cancion mas bien lenta en vez de una mas movidita? besos. felicitame porfa que hoy es mi cumple(15 años). carmen (valencia) ERES EL MEJOR!!!

Object

2908Object24/06/2002 12:58:37

¿Por qué no t cortas el pelo?¿Vas d chusmero o algo?Ay nene eres un payo rabúo y me da lache decirlo y to eh pero ya ves.

Object

2909Object24/06/2002 12:58:38

¿Que pasa por tu cabeza, ahora que eres famoso?. ¿Como ves tu carrera?. ¿Con que canción te identificas más?. Te deseo la mayor suerte del mundo. Disfruta todo lo que puedas. Un besazo. Marta de Madrid

Object

2910Object24/06/2002 12:58:41

Fuiste a la manifestación del 20j? qué piensas del decretazo? saludos de la ciudadana garcía que mucho te admira y que te desea, te dediques en un futuro a la ópera...

Object

2911Object24/06/2002 12:58:43

Hola guapeton ¿Qué es lo más bonito que has vivido dentro de la academia?.Marta(Tenerife)

Object

2912Object24/06/2002 12:58:44

hola Busta. ¿dejarias todo por la música?( maria josé.)(alicante)

Object

2913Object24/06/2002 12:58:44

hola, cuanto llevas vendio? cómo te sienta eso?

Object

2914Object24/06/2002 12:58:45

hola david es increible que pueda hablar contigo (un sueño)¿te sientes respaldado por el fenomeno fans que se ha desatado especialmente contigo o asutado y agobiado por que tantas miles de chicas quieran saber todo sobre ti y sean capaces de hacer cualquier cosa por solo verte?Un beso de un amiguete tuyo,felicidades por tu disco.Fer(zrgza)

Object

2915Object24/06/2002 12:58:51

¿Qué le dirias a una persona que como tú quiere llegar a ser artista? gisela y natalia (girona)

Object

2916Object24/06/2002 12:58:54

hola david! Soy una vitoriana de 18 años.Mi pregunta es q si tu gira pasará por Vitoria. Un besazo de todo corazón de Maria.

Object

2917Object24/06/2002 12:58:55

Bustamante que les dirias a tus fans que estan fuera de españa??? Te kiero Noe, la francesita

Object

2918Object24/06/2002 12:59:00

Te escribe una cantabraza de 17 añazos. Antes salias por Renedo? Esq creemos que te hemos visto alguna vez por ahi y mi novio t conoce..bueno. Desde aqui, te deseo la mayor suerte del mundo porque te lo mereces..eres un tio d puñetera madre!!!!!ese busta!!!!!!te queremos....

Object

2919Object24/06/2002 12:59:06

Bustamante me podrias definir a cada uno de tus compañeros con tan solo una palabra. Suerte en tu carrera en solitario, te mereces todo lo que esta pasando!

Object

2920Object24/06/2002 12:59:09

como te puede gustar gisela? pero si es una chica y a ti solo te gustan los chicos! ademas es tiene la cara de mono o no tas fijao nunca?

Object

2921Object24/06/2002 12:59:09

maria,oviedo:busta tienes ganas de venir a asturias? ya k no habias venido en concierto con los demas chicos? esperamos k si pk aki te keremos muchiisimo.1 besazo david.

Object

2922Object24/06/2002 12:59:11

David, tras un día agotador rodeado de miles de fans, cuando llegas al hotel, ¿te sientes sólo?.Un Beso.Verónica (Cantabria).

Object

2923Object24/06/2002 12:59:15

hola busta!!!!!!!1q tal, solo una pergunta, soy Carmen de Salamanca y te vi con el pase vip, te queria pregunta, como te sentirias si uno de tus pedazos de discos, se encontrara en una de las "mantas". un besazo, TQ

Object

2924Object24/06/2002 12:59:16

Hola David:Eres el mejor.Puedes llegar a tener algo con Gisela? Esperamos que si porque haceis muy buena pareja. Desde que te vimos en la academia fuiste el que mas nos gustabas.Alex tambien nos gusta mucho.Nosotras te mandamos el collar de la estela cantabra con otras amigas mas.Te llego? Y te gusto? ESperamos que si.Y haber si te le pones.Adios.Sara y Lucia(santander)

Object

2925Object24/06/2002 12:59:20

hola, busta ¿que ha supuesto para ti el paso por la academia?¿ha cambiado mucho tu vida personal?

Object

2926Object24/06/2002 12:59:21

Busta! dime el hotel en el q estaras en mallorca

Object

2927Object24/06/2002 12:59:22

Soy Irache de Ramales: Que prefieres usar ¿calzoncillo largo o slip?

Object

2928Object24/06/2002 12:59:28

¿Es dificil seguir siendo humilde y que no se te suban los humos a la cabeza? Yo creo que es complicado... ¿como lo llevas? Joan (Sabadell)

Object

2929Object24/06/2002 12:59:29

Hola Bustamante soy Angela de Catarroja (Valencia). En primer lugar darte la enhorabuena por tu disco,¡ES FABULOSO! Bueno,vamos a la pregunta te a costado mucho grabar tu disco y el videoclip. ¿cual piensas que va ser tu proximo single?Te amo 679837449 llamame por favor eres un artistazo.

Object

2930Object24/06/2002 12:59:42

hola guapeton¡¡¡ que tal??? gracias por perder un ratillo de tu escaso tiempo libre en estar contestando a tantas preguntas que tus fans te realizamos enhorabuena por tu cd mi pregunta:stas orgulloso d tu cd ???yo siiiiiiiii¡¡¡adios guapo.lourdes de madrid.

Object

2931Object24/06/2002 12:59:42

Hola busta que tal la gira??te gustaria ser cantante hasta que no puedas serlo mas o tienes un limite de años para el sueño de tu vida??? Un beso desde suiza,Tamara.

Object

2932Object24/06/2002 12:59:43

David, sabes que todo lo que sube tiende a bajar? Saludos

Object

2933Object24/06/2002 12:59:45

hola soy Merche me podrias decir con quien te gustaria formar un duo en un escenario

Object

2934Object24/06/2002 12:59:51

David: Pasas por san sebastian en tu gira? es que en ningún lado nos lo aclaran. Puedes darnos un toke? es que te llamamos y no nos coges. nuestro número es 659772206

Object

2935Object24/06/2002 12:59:54

Hola Bustamante! Te guste que te imiten llorando? un besazo

Object

2936Object24/06/2002 12:59:54

¿Que es lo que mas valoras en una persona, y lo que mas detestas?. sigue asi de sencillo.Esther

Object

2937Object24/06/2002 12:59:56

busta ahora que todo te va tan bien¿no temes que un dia esto se acabe?POR MI NO ACABARA NUNCa.un beso

Object

2938Object24/06/2002 12:59:56

hola david.crees que has aprendido mucho en este tiempo?te esperabas que todo esto iba a ser un boom asi?un beso.sandra.

Object

2939Object24/06/2002 12:59:58

BUSTAMANTE SOY SALOME VENDRAS A VALENCIA A FIRMAR? ERES EL MEJOR DE SALOME, NO CAMBIES NUNCA TE APOLLARE BESOS ESPERO Q ASTA PRONTO!!!!

Object

2940Object24/06/2002 01:00:11

David: Me gustaria verte y decirte ¡¡¡¡¡¡¡¡¡Compañero!!!!!!!! Soy una chica de Bilbao, que siempre ha estado muy unida a tu tierra. ¿Por que no vas a dar ningun concierto en Vizcaya, estando tan cerca de Cantabria? El dia que cantas en San Vicente me caso, me gustaria poder ir a verte, pero para mi ese dia es mas especial estar en la Iglesia. Un besote, eres el mejor.

Object

2941Object24/06/2002 01:00:15

david! q piensas q creen tus amigos de ti? ana MALAGA CATHyHELL

Object

2942Object24/06/2002 01:00:15

David Bustamante , despues detu paso por la academia, como te va la vida de cantante. contesta. por cierto me llamo luis.

Object

2943Object24/06/2002 01:00:19

Hola David!! Me gustaría que me dijeras cuál es tu mayor defecto (si es que tienes alguno, jeje!!) Besos dulces y traviesos para tí. Inma (Granada)

Object

2944Object24/06/2002 01:00:19

Hola wapisimo primero decirte que tu disco inmejorable y que gracias x firmarme la camiseta con tucara en el aeropuerto de Barcelona y espero que ayas leido la carta que te di me gustaria saber si pasa en concierto x Barcelona ya que lo e mirado y no pone nada. Pasaras x Barcelona???? un besazo enorme te quiero. Sandra Arranz Martinez

Object

2945Object24/06/2002 01:00:22

una vez fuera de la academia cada concursante ha sacado su disco ¿existe alguna rivalidad entre vosotros?

Object

2946Object24/06/2002 01:00:26

Hola David, te escribo desde Argenina PAra contarte que te sigo todos los programas y que me encantaria tener tu CD ¿Tenés pensado venir a recorrer America, mira que aca tenés una fans deseosa de conocerte?

Object

2947Object24/06/2002 01:00:27

Irache de Ramales: ¿Me podrías mandar una foto dedicada por favor?

Object

2948Object24/06/2002 01:00:31

¿No te parece que un artista debe tener algo que decir y no sólo una buena voz o un buen físico?

Object

2949Object24/06/2002 01:00:38

tu single da pena pero es porque lo cantas tu, que te parece que tu disco sea el mas malo de todos los que han sacado disco de esa academia?

Object

2950Object24/06/2002 01:00:51

Hola Busta, felicidades por tu triunfo. Yo era una asidua seguidora de OT pero ahora me parece que las discográficas os están manejando como a marionetas, y eso me disgusta porque siempre os he considerado como gente maravillosa, joven y con ilusión y habéis caido en esta jungla del mercado musical, muy a vuestro pesar, quizás. Qué me puedes decir sobre esto? gracias, un besote. Sabrina

Object

2951Object24/06/2002 01:00:54

DAVID SOY D EMADRID QUE PENSA DE TODO ESTO QUE TE STA PASANDO QUIERO QUE EM NADES UNA SLUDO Y QUE BUENO ME LLAMES JAJAJ A625458736

Object

2952Object24/06/2002 01:00:58

hola busta.¿QUE TAL TE VA EL DISCO? inma(alicante)

Object

2953Object24/06/2002 01:01:08

Hola bustamante. ¿Crees que dentro de unos años seguiran apollandote? Elisa (mallorca)

Object

2954Object24/06/2002 01:01:09

Busta ¿te das cuenta de que cuando aparezcan los praticipantes del nuevo operación triunfo (o los próximos de popstars), es muy posible que vosotros ( 1ª generación) quedéis relegados a un lugar bastante más lejano del éxito que el actual? ¿estás preparado para que te olviden?

Object

2955Object24/06/2002 01:01:09

David, ¿qué recuerdo te llevaste el día que grabastéis akí en Cantabria la gala "Bustamante y amigos"?.Verónica(Cantabria).

Object

2956Object24/06/2002 01:01:14

Que les dirias a tus fans que estan fuera de españa? Nosotr@s tambien te queremos un beso campeon! Noe, la francesita vendras a dar un concierto a Paris o fuera de españa???

Object

2957Object24/06/2002 01:01:14

David ¿Qué es lo que más te gusta hacer ? además de cantar. Mucha suerte eres el mejor. Raquel

Object

2958Object24/06/2002 01:01:15

bustamante.¿quien esta en tu corazon "ademas de ti"?

Object

2959Object24/06/2002 01:01:15

Hola,me llamo Ana. ¿tu crees que estas preparado para la caida?

Object

2960Object24/06/2002 01:01:17

Hola, David. Antes de nada, eres el mejor. Mi canción prefe es "Duda de amor".¿Es cierto que vas a rodar "Diario de una becaria" de Josetxo San Mateo? 1 Besazo. Bea, Cuenca.

Object

2961Object24/06/2002 01:01:23

¿Qué vas a hacer cuando se termine todo este sueño que estas viviendo?

Object

2962Object24/06/2002 01:01:27

hola busta cuando actuas en madrid y donde?besos

Object

2963Object24/06/2002 01:01:28

Hola Busta. Soy gallega y he estado en tu pueblo San Vicente de la Barquera el año pasado en septiembre. Es precioso! recomiendame un rincón de esos que solo la gente de allí conoce para cuando vuelva a visitarlo...Un beso y sigue así de simpático. Lucía. A Coruña (flipé con los gritos de apoyo a ti en el concierto de Coruña de OT)

Object

2964Object24/06/2002 01:01:32

ahhhh

Object

2965Object24/06/2002 01:01:34

Hola Busta. ¿Con cúal de las canciones de tu disco te sientes más identificado? Adiós guapo

Object

2966Object24/06/2002 01:01:36

Hola David, enhorabuena por tu disco. Me gustaria que nos dijeras si vas a venir a Madrid a firmar discos y cuando (si lo sabes). Y, si en tu gira pasarás Madrid capital. Espero que sí. Muchos besos. Lorena.

Object

2967Object24/06/2002 01:01:46

Hola David! Cantas en la ducha? te quiero mucho Aina(bcn)

Object

2968Object24/06/2002 01:01:47

hola guapeton!sy paula, d 17 años, cantabria.Como t sientes despues de ser un chico normal a ser uno d los + admirados d España? eso es un privilegio...ahora las nenas no se te resisten...todas nos peleamos por ti! asi q cuando t vas a echar una novia??? una cosa, si eso cantabra, y mejor si soy yo...muchos besos, titin.

Object

2969Object24/06/2002 01:01:50

BUSTAMANTE ¿CREES DE VERDAD Q YA ERES TODO UN SUPERMAN O TE QUEDA ALGO POR ALCANZAR?BESOS DESDE TU TIERRA (TAMARA)

Object

2970Object24/06/2002 01:01:50

marta malaga como describirias la parte de op. triunfo q no ven los espectadores?

Object

2971Object24/06/2002 01:01:52

hola David,lo 1ºque te queria decir es que eres el mejor cantante del mundo entero.¿te han servido mucho tus clases en la academia? por favor no cambies nunca.Irene,15,madrid

Object

2972Object24/06/2002 01:01:54

Vendrás o pasarás por Tenerife

Object

2973Object24/06/2002 01:01:55

Hola David: ¿Piensas que tu nivel de popularidad tan bien trabajado puede cambiar aspectos de tu vida o forma de ser? Yo espero que no.

Object

2974Object24/06/2002 01:02:00

Titin,me encanta tu disco y compré dos pero que se siente al tener un disco propio cundo antes eras un chico de pueblo normal y corriente?te quiero demasiado para yo no ser nadie un beso judit martinez barcelona.

Object

2975Object24/06/2002 01:02:02

Bustamante,¿poruqe en tu gira de verano, no pasas por San Sebastian? Aqui tambien te queremos. Un besazo. MARINAXBUSTA

Object